Məlumat

Qısa ardıcıllığın dəqiq uyğunluğu üçün NCBI partlayışı

Qısa ardıcıllığın dəqiq uyğunluğu üçün NCBI partlayışı


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Mən 'refseq_rna' verilənlər bazasında NCBI Blast istifadə edərək insan transkriptomunda 'ATTGNNNNGCAAACCA' ardıcıllığına dəqiq uyğunluqlar üçün Blast etməyə çalışıram. Bununla belə, mən əsas sorğu etdikdə "Əhəmiyyətli oxşarlıq tapılmadı" alıram.

Ardıcıllığın ortasındakı N-lərə diqqət yetirin, əgər mən 'AGCGGATTGCAAAGCAAACCA' ardıcıllığını verən bu N-lərdən xilas olsam, insan MeCP2 geninin 3' UTR-də uyğunluq əldə edirəm (bu düzgündür). Mən başa düşmürəm ki, bura N hərflərinin əlavə edilməsi niyə işləmir.

Mən kömək bölməsinə baxdım və inanıram ki, bu, daha qısa ardıcıllığın daha az “statistik əhəmiyyətli” olması ilə əlaqədar ola bilər. Çıxışın statistik əhəmiyyəti mənim üçün tamamilə əhəmiyyətsizdir, ona görə də mən "Gözlənilən Dəyər"i 100000000000000 olaraq təyin etdim. Bununla belə, yenə də eyni nəticəni alıram.

Mən də formaya 4 söz ölçüsünü təqdim etmək imkanı vermək üçün səhifənin HTML-ni dəyişdirməyə çalışdım. Bu keçdi, amma yenə də "Əhəmiyyətli oxşarlıq tapılmadı" aldım.

Kimsə mənə bu işdə kömək edə bilərmi? Hiss edirəm ki, qısa ardıcıllığı axtarmaq bu qədər çətin olmamalıdır.


FASTA sürətli üçün evristikadan istifadə edən başqa bir çox istifadə edilən ardıcıllıq oxşarlığı axtarış vasitəsidir yerli hizalanma axtarışı.

SSEARCH optimaldır (evristikaya əsaslanandan fərqli olaraq) yerli Smith-Waterman alqoritmindən istifadə edərək hizalama axtarış aləti. Optimal axtarışlar sizə verilən parametrlər üçün ən yaxşı uyğunlaşma xalını tapmağınıza zəmanət verir.

PSI-Search uzaqdan əlaqəli zülal ardıcıllıqlarını tapmaq üçün Smith-Waterman axtarış alqoritminin (SSEARCH) həssaslığını PSI-BLAST profilinin qurulması strategiyası ilə birləşdirir.

GGSEARCH optimal işləyir qlobal-qlobal Needleman-Wunsch alqoritmindən istifadə edərək hizalama axtarışları.

GLSEARCH uyğunlaşmalardan istifadə edərək optimal ardıcıllıq axtarışını həyata keçirir qlobal sorğuda amma yerli verilənlər bazası ardıcıllığında. Bütün qısa sorğu ardıcıllığını daha böyük verilənlər bazası ardıcıllığının bir hissəsinə uyğunlaşdırmaq istədiyiniz zaman bu faydalı ola bilər.

Bu mütəxəssis proqramlar sorğu kimi ardıcıl fraqmentlərdən istifadə edərək verilənlər bazası axtarışına imkan verir.


BLAST nəticələrini necə şərh etmək olar

Beləliklə, daha böyük bir tədqiqat orqanına qoşulmaq istədiyiniz xam ardıcıllıq məlumatlarını əldə etdiniz. Çox güman ki, istinad edəcəyiniz ilk verilənlər bazası Milli Biotexnologiya Məlumat Mərkəzidir (NCBI) BAST (əsas yerli uyğunlaşdırma axtarış vasitəsi). kimi digər mənalı verilənlər bazasına da istinad edə bilərsiniz İsveçrə-Prot, the İnsan genomu brauzeriPfam, cavab verməyə çalışdığınız suallardan və nümunələrinizin xarakterindən asılı olaraq. Nəticələr bir az şərh tələb edən keyfiyyətli tədbirlərlə gəlir.

bir çox versiyaları var PARTİ lakin bu xülasə üçün biz sadəlik üçün nukleotid-nukleotid düzülüşünə sadiq qalacağıq. Verilənlər bazasını sorğuladığınız zaman ardıcıllığınız ən yaxşı hitlər tapılana və keyfiyyət göstəriciləri ilə nəticələrdə bildirilənə qədər hər bir digər ardıcıllıqla müqayisə edilir.

Bəzi hitlər eyni xalları bildirə bilər və buna görə də hər bir parametrin təsvir etdiyi müxtəlif güvən səviyyələrini fərqləndirmək təhlilinizin növbəti mərhələsi üçün ardıcıllığı seçmək üçün lazımdır. Nəticələr aşağıdakı kimi müəyyən edilir:

  • Maksimum xal sorğu ardıcıllığı və verilənlər bazası seqmentləri arasında ən yüksək uyğunlaşma xalıdır (bit bal). Bir növ e-dəyərlə tərs mütənasibdir. Daha böyük bit xalının təsadüfən əldə edilmə ehtimalı kiçik bit balından daha azdır.
  • Ümumi xal eyni db-dən bütün ardıcıllıqların düzülmə xallarının cəmidir
  • Faiz Sorğu Əhatəsi düzülmüş seqmentlərə daxil edilən sorğu uzunluğunun faizidir
  • E-dəyər ardıcıllıq oxşarlığının təsadüfi təsadüf olmadığı ehtimalının ölçüsüdür
  • Faiz Şəxsiyyəti sorğunun düzülmüş ardıcıllıqla nə qədər oxşar olduğunu təsvir edir

İstifadə olunan qiymətləndirmə sisteminin təfərrüatlı izahatını araşdırmadan ballar və ya uyğunlaşdırmaların etibarlılığı haqqında məlumatlı qərar qəbul etmək həqiqətən mümkün deyil. Həm nukleotid, həm də zülal üçün ardıcıllıqlar matrisə yerləşdirilir, sonra xam xal almaq üçün evristik alqoritm tətbiq edilir.

Budur, qırmızı rəqəmlərin götürülən yolu təmsil etdiyi yerli düzülmələr üçün istifadə edilən xal matrisinin nümunəsi. Bu matris bir amin turşusu düzülüşündəndir, lakin əsas model nukleotidlər üçün də eyni qalır. Matrisdəki hər bir baza digər oxdakı cütlüyünə nisbətdə bal alır. halda BLASTn, uyğunluq +1 xal alır, uyğunsuzluq -3 və növbəti hərfə keçmək (boşluq) Xətti rejimə defolt olaraq təyin edilib, lakin siz bunu dəyişə bilərsiniz. Artan boşluq xərcləri daha az boşluq olan uyğunlaşmaların görünməsinə səbəb olacaq. Model ən yüksək xal qazanacaq yolu seçir, burada bu yolun cəmi xam xaldır. Maksimum və Toplam balları almaq üçün bu xal normallaşdırılır.

Elektron dəyər və ya gözlənilən dəyər müəyyən ölçülü verilənlər bazasında təsadüfən görməyi gözlədiyiniz oxşar ardıcıllıqların sayıdır. Tipik olaraq, aşağı e-dəyər ardıcıllıqlar arasında oxşarlığı göstərir və siz ardıcıllıqların homolog olduğunu nəticə çıxara bilərsiniz. Baxmayaraq ki, PARTİ homologiyanı birbaşa ölçmür. Bit hesabından, sorğunun uzunluğundan və verilənlər bazasının ölçüsündən istifadə etməklə hesablanır. Müəyyən bit xalını daha qısa sorğu ilə müqayisədə daha uzun sorğu ilə təsadüfən əldə etmək daha asan olduğundan, daha uzun sorğular daha böyük E-dəyərlərə uyğun gəlir. Daha böyük db müəyyən bir bit xalını təsadüfən daha asan əldə edir, daha böyük db daha böyük bit hesabla nəticələnir.

Bu partlayış çıxışında siz təsadüfi təsadüf nəticəsində bu axtarışda ilk dörd hiti 0 x 10⁰ dəfə görməyinizi gözləyə bilərsiniz, yəni bu hitlər təsadüfi deyil. Onlar da eyni faiz nisbətinə malikdirlər. Bununla da e-dəyərlərin necə şərh edilməsi sualı ortaya çıxır. İki ardıcıllığın bioloji əlaqəli olduğu iddiasını dəstəkləmək üçün yaxşı e-dəyər nədir? Hansı hitləri görməməzliyə vura bilərik... Universal cavab yoxdur, lakin biz bir neçə təlimatla variantları daralda bilərik.

  • Ardıcıllığın uzunluğunu sorğunun faizi kimi yoxlamaq, sorğunuzla bağlı hər bir vuruşun uzunluğuna müəyyən istinad verə bilər.
  • Sorğunun növü istifadə ediləcək ən yaxşı e-dəyəri müəyyən edir
  • Məlumatlardan çıxardığınız nəticələr e-dəyərdən təsirlənəcək

Son dərəcə oxşar ardıcıllıqları tapmaq üçün, sıfırdan çox kiçik diapazonda e-dəyəri olan yüksək xallı ardıcıllıq yaxşı seçimdir.


Quraşdırma

Tərtib edilmiş ikili faylları və ya mənbə faylları buradan yükləmək olar. Kompilyasiya ilə edilə bilər

Ətraflı məlumatı burada tapa bilərsiniz. Ardıcıllıq fayllarından istifadə edərək öz verilənlər bazanızı necə qura biləcəyinizlə bağlı burada müraciət edə bilərsiniz.

BWA, Borrows Wheeler Transform deməkdir. Bu, verilənlərin sıxılmasını asanlaşdıracaq şəkildə çevrilir. Bu, BWA-MEM-in də populyar uyğunlaşmasının əsas ideyasıdır. BWA-MEM indeksləşdirmə və uyğunlaşdırmanı yerinə yetirmək üçün prefiks indeksindən istifadə edir. Heng Li-nin GitHub-da daha dərindən oxuya bilərsiniz.


PCR-Blast?! - (15 noyabr 2004)

Salam! Kimsə mənə deyə bilər ki, mən yalnız primerlərlə bağlı necə BLAST edə bilərəm? Mən genomik DNT-dən şablon kimi istifadə etmək istəyirəm və buna görə də primer spesifikliyi haqqında məlumat lazımdır. BLAT-dan istifadə heç də sakit deyil.(http://www.genome.ucsc.edu/cgi-bin/hgPcr)
Optimallaşdırma addımlarından sonra belə PCR heç də yaxşı görünmür. Daha spesifik primerləri tapmaq üçün nə edə bilərəm?

Siz Genbank saytında (http://www.ncbi.nlm.nih.gov/BLAST/) BLAST seçimindən istifadə etməyə cəhd edə bilərsiniz, Nucleotide-nucleotide BLAST (blastn) istədiyiniz seçimdir. Sadəcə primerlərinizi səhifənin yuxarısındakı qutuya yerləşdirin və aşağıdakı siyahıdan orqanizminizi seçin. Bu sizə primerlərinizin bağlandığı saytların siyahısını və onların nə dərəcədə spesifik olduğunu verəcəkdir.

Daha çox primer dizayn etmək lazımdırsa, internetdə çoxlu pulsuz saytlar var. Mən keçmişdə olduqca uğurla primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) istifadə etmişəm

nə demək istədiyini tam olaraq bilmirsən. Əslində virtual PCR alətinin çox faydalı olduğunu düşünürəm. siz sadəcə primerlərinizi daxil edin və proqram uyğunluqları qaytaracaq, onların arasında bəziləri gözlənilən ölçüdədir, bəziləri isə yox. Hədəflənmiş amplikonunuzla eyni ölçüdə olan birdən çox uyğunluq varsa, primerləriniz kifayət qədər spesifik deyil.

NCBI blastn istifadə edirsinizsə, "Qısa, demək olar ki, dəqiq uyğunluqları axtar" seçin və iki primeriniz arasında bəzi "n" işarələri qoyun.

Aşağıdakı misalla izah etməyə çalışıram: Mən insan genomik DNT ilə işləyirəm.
5' aatgattgtagcaacatcc ÜÇÜN
REV 5' tttaactttcccagctgcc
AF035968 2536-3021 (Chr 5) gücləndirmək istəyirəm. Ancaq çirklənmə və səhv gücləndirmə ilə bağlı problemlərim var və buna görə də səhv məhsulun ardıcıllığını təhlil etməyə çalışdım.
Nəticə belə oldu ki, Chr 6 AL590482 74055-74416 gücləndirilir, çünki primerin hissələri qeyri-spesifik birləşir (ÜÇÜN: 20 bp/ REV: 15/20). Bundan əlavə, REV-Primer üçün qeyri-spesifik (74421-74533) bağlamaq üçün ən azı 3 daha çox mövqe var. Partlayış bu imkanların heç birini göstərmədi. Partlayışdan əvvəl REV Astarını çevirməliyəmmi və ya tərs 5'-3' ardıcıllığından istifadə edə bilərəmmi?
Bəlkə mən proqramı düzgün olmayan şəkildə istifadə edirəm!?
Təşəkkürlər, nabla

In silico PCR AF035968 ilə eyni gen olan ITGA2 genində tək uyğunluğu qaytarır.

silisium PCR nəticəsində:
>chr5:52383069+52383341 AATGATTGTAGCAACATCC TTTAACTTTCCCAGCTGCC
AATGATTGTAGCAACATCCcagacatcccaatatggtgggggacctcacaa
acacattcggagcaattcaatatgcaaggtaagttttggtgctaataggc
caatgttttcataatgtaaaacattatatttatgtaataatatgaaaaa
gtaaggaaaagacaaaaaaataatatacctggtacctaatttaaatca
gaactaataaagaaaaaaacatcagagcattctatgtcttgaatactttg
agaaGGCAGCTGGGAAAGTTAAA

Bu uyğunlaşdırılmış bölgə 2749-3021 arasında AF035968 ilə uyğunlaşır

Sorğu: 1 aatgattgtagcaacatcccagacatcccaatatggtgggggacctcacaaacattcgg 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 2749 aatgattgtagcaacatcccagacatcccaatatggtgggggacctcacaaacacatttgg 2808
integrin alpha 2 36 M I V A T S Q T S Q Y G D L T N T F G

Sorğu: 61 agcaattcaatatgcaaggtaagttttggtgctaataggccaatgttttcataatgtaaa 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2809 agcaattcaatatgcaaggtaagttttggtgctaataggccaatgttttcataatgtaaa 2868
integrin alpha 2 56 A I Q Y A R

Sorğu: 121 acattatatttatgtaataaatatgaaaaagtaaggaaaagacaaagaaaaataatatac 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2869 acattatatttatgtaataaatatgaaaaagtaaggaaaagacaaagaaaaataatatac 2928
integrin alpha 2 2869

Sorğu: 181 ctggtacctaatttaaatcagaactaataaagnnnnnnncatcagagcattctatgtctt 240
|||||||||||||||||||||||||||||||| ||||||||||||| |||||||
Sbjct: 2929 ctggtacctaatttaaatcagaactaataaagaaaaaaacatcagagcattcaatgtctt 2988
integrin alpha 2 2929

Sorğu: 241 gaatactttgagaaggcagctgggaaagttaaa 273
||||||||| |||||||||||||||||||||||
Sbjct: 2989 gaatactttaagaaggcagctgggaaagttaaa 3021
integrin alpha 2 2989

Antisens primeri də eyni gendə olan fraqmentə (5616-5668), lakin fərqli zəncirlə uyğun gəlir. Bu uyğunluğu nəzərə almamaq olar, çünki primerin 3-cü ucunda bəzi uyğunsuzluqlar var və irəli primerlə eyni teldə deyil. Onlar qeyri-spesifik gücləndirməyə səbəb olmayacaqlar.

Beləliklə, mən sorğumu necə təkmilləşdirə bilərəm və hətta qeyri-spesifik uyğunluqları tapa bilərəm?

Digər potensial qeyri-spesifik uyğunluqları əldə etmək üçün sadəcə olaraq Min Mükəmməl Uyğunluq və Min Yaxşı Uyğunluq kimi parametrlərinizi yumşaldın, lakin məncə, standart parametrlərdən istifadə kifayət qədər yaxşıdır.

Səni həqiqətən başa düşdümsə, mən şər deyiləm. Blat-axtarış ilə mən yalnız almaq bir ümumiyyətlə nəticə. Min Perfect Match/ Min Good Match kimi parametrlərdə dəyişiklik nə etməlidir?

Parametrlər proqrama sadəcə olaraq, məsələn, astarlarınızdan birinə uyğun gələn 15 bazaya malik olmalı olan hədəfləri qaytarmağı əmr edir. Əgər rəqəmi 10-a endirsəniz, çox güman ki, çoxlu matçlar əldə edəcəksiniz.


Qısa ardıcıllığın dəqiq uyğunluğu üçün NCBI partlayışı - Biologiya

Dizayn və inkişaf çərçivəsi, C++ kitabxanasına istinad, proqram nümunələri və demolar, Tez-tez verilən suallar və buraxılış qeydləri daxil olmaqla, NCBI C++ alətlər dəsti üzrə hərtərəfli təlimat. Təlimat onlayn olaraq axtarıla bilər və onu bir sıra PDF sənədləri kimi yükləmək olar.

Yükləmələr

Yerli istifadə üçün BLAST icra sənədləri Solaris, LINUX, Windows və MacOSX sistemləri üçün təmin edilmişdir. Əlavə məlumat üçün ftp qovluğunda README faylına baxın. BLAST nukleotid, zülal və tərcümə edilmiş axtarışlar üçün əvvəlcədən formatlaşdırılmış verilənlər bazaları da db alt kataloqu altında yükləmək üçün mövcuddur.

Müstəqil BLAST proqramları ilə istifadə etmək üçün verilənlər bazalarını sıralayın. Bu kataloqdakı fayllar BLAST ilə istifadəyə hazır olan əvvəlcədən formatlaşdırılmış verilənlər bazalarıdır.

Bu sayt CDD üçün tam məlumat qeydlərini, fərdi Mövqe Xüsusi Qiymətləndirmə Matrisləri (PSSMs), mFASTA ardıcıllıqları və qorunan hər bir domen üçün annotasiya məlumatları ilə birlikdə təmin edir. Tam təfərrüatlar üçün README faylına baxın.

Bu sayt XML-də tam məlumat çıxarılmasını və VCF formatında xülasə məlumatları təqdim edir. Bu, ClinVar, MedGen və GTR-də istifadə olunan standart şərtlər haqqında məlumatı ehtiva edən fayllardan ibarətdir.

Müstəqil BLAST proqramları ilə istifadə üçün FASTA formatında verilənlər bazalarını sıralayın. Bu verilənlər bazaları BLAST ilə istifadə edilməzdən əvvəl formatdb istifadə edərək formatlaşdırılmalıdır.

Bu saytda standart düz fayl formatında GenBank-da bütün ardıcıllıq qeydləri üçün fayllar var. Fayllar GenBank bölməsi tərəfindən təşkil edilir və tam məzmun README.genbank faylında təsvir olunur.

GenBank-da kodlaşdırma ardıcıllığının (CDS) tərcümələrinə uyğun zülal ardıcıllıqları hər GenBank buraxılışı üçün toplanır.. Əlavə məlumat üçün kataloqda README faylına baxın.

Bu saytda üç kataloq var: DATA, GeneRIF və alətlər. DATA kataloqu Gen qeydləri üçün ASN.1 məlumatını ehtiva edən alt kataloqlarla yanaşı, GeneID-lərlə əlaqəli bütün məlumatları siyahıya alan faylları ehtiva edir. GeneRIF (Funksiyaya Gen İstinadları) kataloqu tək bir genin funksiyasını və ya iki genin məhsulları arasında qarşılıqlı əlaqəni təsvir edən məqalələr üçün PubMed identifikatorlarını ehtiva edir. Gen məlumatlarını manipulyasiya etmək üçün nümunə proqramlar alətlər kataloqunda təqdim olunur. Təfərrüatlar üçün README faylına baxın.

Bu sayt iki formatda GEO məlumatlarını ehtiva edir: SOFT (Mətn Formatında Sadə Omnibus) və MINiML (İşarələmə Dilində MIAME Notasiyası). Xülasə mətn faylları və əlavə məlumatlar da mövcuddur. Əlavə məlumat üçün README.TXT faylına baxın.

Bu sayt Entrez Genomunda olan orqanizmlər üçün genom ardıcıllığı və xəritəçəkmə məlumatlarını ehtiva edir. Məlumatlar tək növlər və ya növlər qrupları üçün kataloqlarda təşkil edilir. Xəritəçəkmə məlumatları MapView kataloqunda toplanır və növlərə görə təşkil edilir. Ətraflı məlumat üçün kök kataloqdakı README faylına və növ alt kataloqlarındakı README fayllarına baxın.

Bu genomun cari və əvvəlki quruluşları üçün mövcud xəritələşdirmə məlumatlarını ehtiva edən hər bir genom üçün kataloqları ehtiva edir.

Bu saytda nukleotid və zülal ardıcıllığı qeydlərini onların taksonomiya identifikatorları ilə əlaqələndirən fayllarla birlikdə tam taksonomiya verilənlər bazası var. Ətraflı məlumat üçün taxdump_readme.txt və gi_taxid.readme fayllarına baxın.

Bu sayt ftp vasitəsilə yükləmək üçün PubChem Substance, Compound və Bioassay verilənlər bazalarından məlumatları təqdim edir. Verilənlər bazalarının tam yükləmələri Substance və Compound üçün gündəlik, həftəlik və aylıq yeniləmələrlə birlikdə mövcuddur. Maddə və Mürəkkəb məlumatlar ASN.1, SDF və XML formatlarında təqdim olunur. Əlavə məlumat üçün README fayllarına baxın.

Bu sayt Referans Sequence (RefSeq) kolleksiyasındakı bütün nukleotid və zülal ardıcıllığı qeydlərini ehtiva edir. Seçilmiş orqanizmlər (insan, siçan və siçovul kimi) üçün məlumatlar ayrı-ayrı kataloqlarda olduğu halda, ""release"" kataloqu tam kolleksiyanın ən son buraxılışını ehtiva edir. Məlumatlar FASTA və düz fayl formatlarında mövcuddur. Ətraflı məlumat üçün README faylına baxın.

Bu sayt ASN.1, XML və EasySKYCGH formatlarında SKY-CGH məlumatlarını ehtiva edir. Əlavə məlumat üçün skycghreadme.txt faylına baxın.

SNP üçün endirilə bilən məlumatlar.

Bu sayt təqdim edilmiş ardıcıllıq layihəsi tərəfindən təşkil edilmiş növbəti nəsil ardıcıllıq məlumatlarını ehtiva edir.

NCBI verilənlər bazası, alətlər və kommunal proqramlar üçün FTP yükləmə saytı.

Bu sayt VAST uyğunlaşdırma məlumatları və lazımsız PDB (nr-PDB) məlumat dəstləri ilə birlikdə MMDB-dəki bütün qeydlər üçün ASN.1 datasını ehtiva edir. Əlavə məlumat üçün README faylına baxın.

Bu sayt növlər üzrə təşkil edilən iz xromatoqramma məlumatlarını ehtiva edir. Məlumatlara xromatoqramma, keyfiyyət balları, avtomatik əsas zənglərdən FASTA ardıcıllıqları və nişanla ayrılmış mətndə, eləcə də XML formatlarında digər köməkçi məlumatlar daxildir. Ətraflı məlumat üçün README faylına baxın.

Bu saytda FASTA formatında UniVec və UniVec_Core verilənlər bazası var. Ətraflı məlumat üçün README.uv faylına baxın.

Bu sayt 4 rəqəmli layihə kodu ilə təşkil edilmiş bütün genom ov tüfəngi ardıcıllığı məlumatlarını ehtiva edir. Məlumatlara GenBank və GenPept düz faylları, keyfiyyət balları və ümumi statistika daxildir. Əlavə məlumat üçün README.genbank.wgs faylına baxın.

Açıq giriş məlumatlarına ümumiyyətlə genotip/fenotip assosiasiyası tədqiqatlarının xülasəsi, ölçülən dəyişənlərin təsvirləri və protokol və sorğu vərəqləri kimi tədqiqat sənədləri daxildir. Fərdi səviyyəli məlumatlara, o cümlədən fenotipik məlumat cədvəllərinə və genotiplərə giriş müxtəlif səviyyələrdə icazə tələb edir.

ASN.1 və ya DTD formatında NCBI verilənləri üçün spesifikasiyalar data_specs İndeksi səhifəsində mövcuddur. "NCBI_data_conversion.html" çevrilmə alətinə keçid verir.

Jurnal məqalələrinin müəllifi və arxivləşdirilməsi, habelə jurnal məqalələrinin nəşriyyatlardan arxivlərə və arxivlər arasında ötürülməsi üçün etiket dəstləri dəsti. Dörd teq dəsti var: Arxivləşdirmə və Mübadilə Teqləri Seti - Arxivin mövcud çap edilmiş və etiketlənmiş jurnal materialının struktur və semantik komponentlərini mümkün qədər rahat şəkildə ələ keçirmək üçün yaradılmışdır. və onların məzmununa nəzarət edin, hər hansı xüsusi naşir tərəfindən onlara təqdim olunan ardıcıllığı və tənzimləməni qəbul etməmək üçün Məqalə Müəllifi Tag Seti - Yeni jurnal məqalələrinin müəllifi üçün nəzərdə tutulmuşdur NCBI Book Tag Set - NCBI onlayn kitabxanaları üçün həcmləri təsvir etmək üçün xüsusi olaraq yazılmışdır.

Bu xidmət istifadəçilərə əl ilə və ya mətn faylı vasitəsilə təmin edilə bilən PubChem identifikatorları dəstinə uyğun olan birləşmə və ya maddə qeydlərini endirməyə imkan verir. SDF, XML və SMILES daxil olmaqla çoxsaylı yükləmə formatları mövcuddur.

NCBI resursları haqqında yeniliklər üçün Veb/RSS lentlərinə abunə olun.

Təqdimatlar

Tədqiqatçılar, konsorsiumlar və təşkilatlar üçün öz BioLayihələrini qeydiyyatdan keçirmələri üçün interfeys təqdim edən onlayn forma. Bu, tədqiqat üçün genomik və genetik məlumatların təqdim edilməsi üçün başlanğıc nöqtəsi kimi xidmət edir. BioProject qeydiyyatı zamanı məlumatların təqdim edilməsinə ehtiyac yoxdur.

GenBank verilənlər bazasına bir və ya bir neçə təqdimat üçün veb-əsaslı ardıcıllıqla təqdimetmə vasitəsi, təqdimetmə prosesini tez və asan etmək üçün nəzərdə tutulmuşdur.

Növlərin identifikasiyasında istifadə üçün standart genetik lokusdan olan Barkod qısa nukleotid ardıcıllığının GenBank məlumat bazasına təqdim edilməsi üçün alət.

İctimai ardıcıllıq verilənlər bazalarına (GenBank, EMBL və ya DDBJ) daxiletmələrin təqdim edilməsi və yenilənməsi üçün NCBI tərəfindən hazırlanmış müstəqil proqram aləti.O, tək qısa mRNT ardıcıllığını, uzun ardıcıllıqları, çoxlu annotasiyaları, seqmentlərə bölünmüş DNT dəstlərini, həmçinin filogenetik və populyasiya tədqiqatlarının ardıcıllıqlarını düzülmə ilə ehtiva edən sadə təqdimatları idarə etməyə qadirdir. Sadə təqdim etmək üçün əvəzinə onlayn təqdimetmə aləti BankIt istifadə edin.

Sequin ilə eyni funksiyalardan istifadə edərək GenBank-a təqdim etmək üçün ardıcıllıq qeydlərinin yaradılmasını avtomatlaşdıran komanda xətti proqramı. O, ilk növbədə tam genomların və ardıcıllığın böyük partiyalarının təqdim edilməsi üçün istifadə olunur.

NCBI Gene Expression Omnibus (GEO) verilənlər bazasına mikroarray, SAGE və ya kütləvi spektrometriya verilənlər bazası kimi ifadə məlumatlarını təqdim edin.

Bu sayt istifadəçilərə kimyəvi strukturlar, eksperimental bioloji fəaliyyət nəticələri, annotasiyalar, siRNA məlumatları və s. daxil olmaqla PubChem Substance və BioAssay verilənlər bazalarına məlumat təqdim etməyə imkan verir. Bundan əvvəl təqdim edilmiş qeydləri yeniləmək üçün də istifadə edilə bilər.

SNP verilənlər bazası alətləri səhifəsi ümumi təqdimetmə qaydalarına və təqdimetmə dəstəyi sorğusuna keçidlər təmin edir. Səhifədə həmçinin İnsan Genomu Variasiya Cəmiyyətinin nomenklaturasından istifadə edərək insan variasiyası məlumatlarının tək və ya toplu təqdim edilməsi üçün iki xüsusi keçid var.

Təqdimatçılar üçün NCBI-da bütün məlumat təqdimetmə prosesləri ilə əlaqə yaratmaq və məlumat tapmaq üçün vahid giriş nöqtəsi. Hazırda bu, BioProjects və BioSamples-ın qeydiyyatı və WGS və GTR üçün məlumatların təqdim edilməsi üçün interfeys kimi xidmət edir. Bu sayta gələcək əlavələr planlaşdırılır.

Bu keçid iz məlumatlarını təqdim edənlərin öz məlumatları üçün təhlükəsiz NCBI FTP saytını necə əldə edə biləcəyini təsvir edir, həmçinin icazə verilən məlumat formatlarını və kataloq strukturlarını təsvir edir.

Alətlər

Seçilmiş tam eukaryotik və prokaryotik genomlardan oxşar ardıcıllıqlar üçün BLAST axtarışını həyata keçirir.

RefSeqGene/LRG dəstindəki genomik ardıcıllıqların BLAST axtarışını həyata keçirir. Standart displey Qrafik displeydə düzülmələri nəzərdən keçirmək üçün hazır naviqasiya təmin edir.

Bioloji ardıcıllıqlar arasında yerli oxşarlıq bölgələrini tapır. Proqram nukleotid və ya zülal ardıcıllığını ardıcıl verilənlər bazası ilə müqayisə edir və uyğunluqların statistik əhəmiyyətini hesablayır. BLAST ardıcıllıqlar arasında funksional və təkamül əlaqələri haqqında nəticə çıxarmaq, həmçinin gen ailələrinin üzvlərini müəyyən etmək üçün istifadə edilə bilər.

Nukleotid və ya Zülal verilənlər bazalarından GI və ya qoşulma nömrələri faylını və ya digər Entrez verilənlər bazalarından unikal identifikatorlar faylını yükləməklə bir çox Entrez verilənlər bazasından qeydləri əldə etməyə imkan verir. Axtarış nəticələri müxtəlif formatlarda birbaşa kompüterinizdə yerli faylda saxlanıla bilər.

Zülal ardıcıllığını təsnif etmək və onların təkamül əlaqələrini araşdırmaq üçün müstəqil proqram. CDTree mövcud Conserved Domain (CDD) qeydlərini və iyerarxiyalarını idxal edə, təhlil edə və yeniləyə bilər, həmçinin istifadəçilərə özlərini yaratmağa imkan verir. CDTree, Entrez CDD və Cn3D ilə sıx inteqrasiya olunub və istifadəçilərə zülal domenlərinin düzülmələrini yaratmağa və yeniləməyə imkan verir.

COBALT RPS-BLAST, BLASTP və PHI-BLAST istifadə edərək qorunan domen verilənlər bazasından, zülal motivləri verilənlər bazasından və ardıcıllıq oxşarlığından əldə edilən cüt məhdudiyyətlər toplusunu tapan çoxlu zülal ardıcıllığının uyğunlaşdırılması vasitəsidir.

NCBI-nin Entrez axtarış xidmətindən 3 ölçülü strukturlara baxmaq üçün müstəqil proqram. Cn3D Windows, Macintosh və UNIX sistemlərində işləyir və ən məşhur veb-brauzerlərdən məlumat almaq üçün konfiqurasiya edilə bilər. Cn3D eyni vaxtda strukturu, ardıcıllığı və düzülməni göstərir və güclü annotasiya və hizalama redaktə xüsusiyyətlərinə malikdir.

Zülal ardıcıllığında mövcud olan qorunan domenləri müəyyən edir. CD-Axtarış, Sorğu ardıcıllığını Qorunan Domen Verilənlər Bazasında (CDD) mövcud olan qorunmuş domen düzülmələrindən hazırlanmış mövqe-xüsusi hesab matrisləri ilə müqayisə etmək üçün RPS-BLAST (Tərs Mövqe-Xüsusi BLAST) istifadə edir.

Adi veb sorğu interfeysindən kənarda NCBI-nin Entrez sistemi daxilində məlumatlara çıxışı təmin edən alətlər. Onlar proqram proqramları daxilində Entrez tapşırıqlarının avtomatlaşdırılması metodunu təmin edirlər. Hər bir yardım proqramı xüsusi axtarış tapşırığını yerinə yetirir və sadəcə olaraq xüsusi formatlaşdırılmış URL yazmaqla istifadə edilə bilər.

Sorğu ardıcıllığını (nukleotid və ya protein) GEO verilənlər bazasında mikroarray və ya SAGE platformalarına daxil edilmiş GenBank ardıcıllığına uyğunlaşdırmaq üçün alət.

Bu alət nukleotid və ya zülal ardıcıllığını genomik ardıcıllıq verilənlər bazası ilə müqayisə edir və Əsas Yerli Uyğunlaşdırma Axtarış Aləti (BLAST) alqoritmindən istifadə edərək uyğunluqların statistik əhəmiyyətini hesablayır.

NCBI-nin Remap aləti istifadəçilərə annotasiya məlumatlarını layihələndirməyə və xüsusiyyətlərin yerlərini bir genomik məclisdən digərinə və ya baza analizi vasitəsilə baza vasitəsilə RefSeqGene ardıcıllığına çevirməyə imkan verir. Remappingin sərtliyini tənzimləmək üçün seçimlər təmin edilir və xülasə nəticələri veb-səhifədə göstərilir. Tam nəticələr NCBI-nin Genome Workbench qrafik görüntüləyicisində baxmaq üçün endirilə bilər və yenidən qurulmuş funksiyalar üçün annotasiya məlumatları, habelə xülasə məlumatları da yükləmək üçün mövcuddur.

Ardıcıllıq məlumatlarına baxmaq və təhlil etmək üçün inteqrasiya olunmuş proqram. Genome Workbench ilə siz NCBI-də ictimaiyyətə açıq olan ardıcıllıq verilənlər bazalarında məlumatlara baxa və bu məlumatları öz məlumatlarınızla qarışdıra bilərsiniz.

İstifadəçilərə verilənlər bazası axtarış nəticələri və ya digər proqram proqramları tərəfindən yaradılmış çoxsaylı düzülmələri vizuallaşdırmağa imkan verən interaktiv veb tətbiqi. MSA Viewer istifadəçilərə düzülmə yükləməyə və əsas ardıcıllığı təyin etməyə və böyütmə və rəngin dəyişdirilməsi kimi xüsusiyyətlərdən istifadə edərək məlumatları araşdırmaq imkanı verir.

Molekulyar biologiya üçün portativ, modul proqram təminatı istehsal etmək üçün NCBI tərəfindən istifadə edilən proqram təminatı və məlumat mübadiləsi spesifikasiyaları toplusu. Alətlər qutusundakı proqram təminatı ilk növbədə Beynəlxalq Standartlar Təşkilatının (ISO) məlumat təqdimat formatı olan Abstract Syntax Notation 1 (ASN.1) formatında qeydləri oxumaq üçün nəzərdə tutulmuşdur.

Laboratoriya üçün xüsusi protokollar əsasında multipleks qısa tandem təkrar (STR) DNT profillərinin qiymətləndirilməsini asanlaşdıran ictimai domen keyfiyyət təminatı proqram paketi. OSIRIS müstəqil əldə edilmiş riyazi əsaslı ölçü alqoritmindən istifadə edərək xam elektroforez məlumatlarını qiymətləndirir. O, iki yeni yüksək keyfiyyət ölçüləri təklif edir - uyğunluq səviyyəsi və ölçü qalığı. O, fon səs-küyü parametrləri, fərdiləşdirilmiş adlandırma konvensiyaları və əlavə daxili laboratoriya nəzarətləri kimi laboratoriyaya xas imzaları yerləşdirmək üçün fərdiləşdirilə bilər.

İstifadəçi ardıcıllığında və ya verilənlər bazasında olan ardıcıllıqla bütün açıq oxu çərçivələrini tapan qrafik analiz aləti. On altı müxtəlif genetik koddan istifadə edilə bilər. Çıxarılan amin turşusu ardıcıllığı müxtəlif formatlarda saxlanıla və BLAST istifadə edərək zülal verilənlər bazasında axtarıla bilər.

Primer-BLAST aləti PCR primerlərini ardıcıllıq şablonuna dizayn etmək üçün Primer3-dən istifadə edir. Potensial məhsullar daha sonra nəzərdə tutulan hədəfin spesifikliyini yoxlamaq üçün istifadəçi tərəfindən müəyyən edilmiş verilənlər bazalarına qarşı BLAST axtarışı ilə avtomatik təhlil edilir.

Zülalların genomik nukleotid ardıcıllığına uyğunlaşdırılmasının hesablanması üçün bir yardım proqramı. O, Needleman Wunsch qlobal hizalama alqoritminin dəyişikliyinə əsaslanır və xüsusi olaraq intronlar və birləşmə siqnalları üçün hesablanır. Bu alqoritm sayəsində ProSplign birləşmə yerlərinin müəyyən edilməsində dəqiqdir və ardıcıllıq xətalarına dözümlüdür.

PUG proqram interfeysi vasitəsilə PubChem xidmətlərinə çıxışı təmin edir. PUG istifadəçilərə məlumatları endirməyə, kimyəvi struktur axtarışlarına başlamağa, kimyəvi strukturları standartlaşdırmağa və E-utilitlərlə qarşılıqlı əlaqə yaratmağa imkan verir. PUG-ə ya standart URL-lərdən istifadə etməklə, ya da SOAP vasitəsilə daxil olmaq olar.

Standartlaşdırma, PubChem terminologiyasında, töhfə verənlərin orijinal strukturlarından PubChem Compound qeydlərini yaratmaq üçün istifadə edilən eyni üsulla kimyəvi strukturların emalıdır. Bu xidmət istifadəçilərə PubChem-in təqdim etmək istədikləri istənilən strukturu necə idarə edəcəyini görməyə imkan verir.

PubChem Struktur Axtarışı PubChem Mürəkkəb Verilənlər Bazasını kimyəvi quruluşa və ya kimyəvi quruluş nümunəsinə görə sorğulamağa imkan verir. PubChem Sketcher sorğunun əl ilə çəkilməsinə imkan verir. İstifadəçilər həmçinin PubChem Mürəkkəb İdentifikatoru (CID), SMILES, SMARTS, InChI, Molekulyar Formula və ya dəstəklənən struktur fayl formatının yüklənməsi ilə struktur sorğu daxiletməsini təyin edə bilərlər.

SNP verilənlər bazasında axtarış aparmaq üçün BLAST istifadə edərək genotip, metod, populyasiya, təqdim edən, markerlər və ardıcıllıq oxşarlığı üzrə axtarışa imkan verən müxtəlif alətlər mövcuddur. Bunlar dbSNP əsas səhifəsinin sol tərəfindəki ""Axtarış"" altında əlaqələndirilir.

Nukleotid və ya zülal ardıcıllığının konfiqurasiya edilə bilən qrafik görüntüsünü və həmin ardıcıllıqla şərh edilmiş xüsusiyyətləri təmin edir. NCBI ardıcıllığı verilənlər bazası səhifələrində istifadə etməklə yanaşı, bu görüntüləyici daxil edilə bilən veb səhifə komponenti kimi mövcuddur. Təfərrüatlı sənədlər, o cümlədən API İstinad bələdçisi, izləyicini öz səhifələrində yerləşdirmək istəyən tərtibatçılar üçün mövcuddur.

cDNA-to-Genomik ardıcıllığın uyğunlaşdırılmasını hesablamaq üçün bir yardım proqramı. O, Needleman-Wunsch qlobal hizalama alqoritminin dəyişikliyinə əsaslanır və xüsusi olaraq intronlar və birləşmə siqnalları üçün hesablanır. Bu alqoritm sayəsində Splign birləşmə yerlərini təyin etməkdə dəqiqdir və ardıcıllıq səhvlərinə dözümlüdür.

Filogenetik ağac məlumatlarını yaratmaq və göstərmək üçün alət. Tree Viewer öz ardıcıllıq məlumatlarınızı təhlil etməyə imkan verir, PDF kimi çap edilə bilən vektor şəkilləri istehsal edir və veb səhifəyə daxil edilə bilər.

Vektor mənşəli ola bilən nuklein turşusu ardıcıllığının seqmentlərini tez müəyyən etmək üçün sistem. VecScreen ixtisaslaşdırılmış qeyri-ehtiyatsız vektor verilənlər bazasında (UniVec) istənilən ardıcıllıqla uyğun gələn seqmentlər üçün sorğu ardıcıllığını axtarır.

Oxşar zülal 3 ölçülü strukturları müəyyən edən kompüter alqoritmi. MMDB-dəki hər struktur üçün struktur qonşuları əvvəlcədən hesablanır və MMDB Struktur Xülasə səhifələrindəki keçidlər vasitəsilə əldə edilə bilər. Bu qonşular yalnız ardıcıllıq müqayisəsi ilə tanınmayan uzaq homologları müəyyən etmək üçün istifadə edilə bilər.


Mühazirə 2: Yerli Uyğunlaşma (BLAST) və Statistika

Videonu iTunes U və ya İnternet Arxivindən yükləyin.

Təsvir: Bu mühazirədə professor Burge klassik və yeni nəsil ardıcıllığı nəzərdən keçirir. Daha sonra o, yerli alignment (BLAST) və bəzi əlaqəli statistik məlumatları təqdim edir.

Təlimatçı: Kristofer Burge

Mühazirə 1: Giriş.

Mühazirə 2: Yerli Uyğunlaşma.

Mühazirə 3: Qlobal Alignment.

Mühazirə 4: Müqayisəli Geno.

Mühazirə 5: Kitabxana Kompleksi.

Mühazirə 6: Genom Assambleyası

Mühazirə 7: ChIP-seq Analizi.

Mühazirə 8: RNT-ardıcıllığı Ana.

Mühazirə 9: Modelləşdirmə və Dis.

Mühazirə 10: Markov və Hidd.

Mühazirə 11: RNT Orta S.

Mühazirə 12: Giriş.

Mühazirə 13: Prot. Proqnozlaşdırma.

Mühazirə 14: Prot. Proqnozlaşdırma.

Mühazirə 15: Genlərin Tənzimlənməsi.

Mühazirə 16: Protein İnterak.

Mühazirə 17: Məntiqi Modelləşdirmə .

Mühazirə 18: Chr.

Mühazirə 19: Kəşf etmək.

Mühazirə 20: İnsan Genetikası.

Mühazirə 21: Sintetik Biolo.

Mühazirə 22: Səbəbiyyət, Natu.

Aşağıdakı məzmun Creative Commons lisenziyası ilə təmin edilir. Sizin dəstəyiniz MIT OpenCourseWare-ə yüksək keyfiyyətli təhsil resurslarını pulsuz təklif etməyə davam edəcək. İanə etmək və ya yüzlərlə MIT kursundan əlavə materiallara baxmaq üçün ocw.mit.edu ünvanında MIT OpenCourseWare saytına daxil olun.

PROFESSOR: Yaxşı. Beləliklə, bu gün biz klassik ardıcıllığı və növbəti nəsil və ya ikinci nəsil sekvensiyanı qısaca nəzərdən keçirəcəyik ki, bu da haqqında danışacağımız analitik metodların işlədiyi bir çox məlumatı təmin edir. Biz daha sonra yerli uyğunlaşdırma a la BLAST və bununla bağlı bəzi statistik məlumatları təqdim edəcəyik.

Beləliklə, birinci mövzu ilə bağlı bir neçə qısa maddə. Yaxşı. Beləliklə, bu gün biz ilk növbədə ardıcıllıq haqqında danışacağıq. Ənənəvi - və ya Sanger ardıcıllığı - sonra qısaca növbəti nəsil və ya ikinci nəsil ardıcıllığı. Və sonra yerli uyğunlaşmalar haqqında danışın.

Beləliklə, ardıcıllıq hissəsi üçün fon, Metzger icmalı sizə lazım olan hər şeyi əhatə edir. Və uyğunlaşma üçün - biz bu gün yerli uyğunlaşma, çərşənbə axşamı qlobal uyğunlaşma haqqında danışacağıq - sonra mətnin dördüncü və beşinci fəsilləri onu olduqca yaxşı əhatə edir. Beləliklə, mətn budur. Əgər onu alıb-almamağa qərar verməmisinizsə, onu burada saxlayacağam. Dərsdən sonra gəlib vərəqləyə bilərsiniz.

Ardıcıllıq əsasən DNT səviyyəsində aparılır. Orijinal materialın RNT olub-olmamasından asılı olmayaraq, adətən DNT səviyyəsində DNT və ardıcıllığa çevrilir. Beləliklə, biz tez-tez DNT haqqında bir növ sim kimi düşünəcəyik. Ancaq burada göstərildiyi kimi əslində üç ölçülü bir quruluşa sahib olduğunu xatırlamaq vacibdir. Və tez-tez, ortada göstərildiyi kimi, əsaslar və onların hidrogen bağları və sair haqqında düşündüyünüz iki ölçülü bir təsvir şəklində düşünmək faydalıdır.

Siçanım bu gün nədənsə işləmir, amma inşallah buna ehtiyacımız olmayacaq.

Beləliklə, ardıcıllığın kimyası fərdi əsasların kimyası ilə çox sıx bağlıdır. Və burada aktual olacaq həqiqətən üç əsas növ var. Ribonükleotidlər, deoksiribonukleotidlər, sonra Sanger ardıcıllığı üçün, dideoksiribonukleotidlər.

Bəs kim mənə deyə bilər ki, bu strukturlardan hansı həmin adlardan hansına uyğun gəlir? Həmçinin, xahiş edirəm adınızı mənə bildirin və yəqin ki, semestrin sonuna doğru bəzi adlarınızı xatırlamağa çalışacağam. Yaxşı, hansılardır? Bəli, adınız nədir?

Auditoriya: Mən Simona. Beləliklə, ribonukleotid yuxarı sağdadır. Deoksi onun altında olandır. Dideoksi isə solda olandır.

PROFESSOR: Yaxşı, bu düzgündür. Beləliklə, bunları yadda saxlamağın bir yolu əsasların nömrələnməsidir. Beləliklə, ribo şəkərindəki karbonlar bir nömrələnir, buna görə də əsasın bağlandığı karbon 1-dir. Burada ikisi var, RNT-də OH və DNT-də sadəcə H var. Və sonra üç çox vacibdir. Dörd, sonra beş. Beləliklə, beşi fosfatlara bağlanır, bu da bazanı şəkər fosfat onurğasına birləşdirəcəkdir. Və üçü uzatdığınız yerdir. Bu, böyüyən bir zəncirdə növbəti baza əlavə edəcəyiniz yerdir.

DNT polimeraza şablon və bəzi dideoksi nukleotidlər versəniz nə olacaq? 3-əsas OH olmadığı üçün genişləndirə bilməyəcək. Və bütün kimya OH tələb edir. Beləliklə, Fred Sangerin 1980-ci illərdə Nobel mükafatına layiq görüldüyü klassik və ya Sanger ardıcıllığının əsası budur - məncə, bu, 70-ci illərdə işlənib hazırlanmışdır - və bu, həqiqətən də ardıcıllığın əksəriyyətinin və ya demək olar ki, hamısının əsasını təşkil edir. bəzi yeni texnologiyalar ortaya çıxana qədər 2000-ci illərin əvvəllərinə qədər DNT ardıcıllığı. Və dideoksi nukleotidlərin bu xüsusi xüsusiyyətindən istifadə edərək, böyüyən zənciri dayandırırlar.

Beləliklə, bizim şablon DNT-miz olduğunu təsəvvür edin. Beləliklə, ardıcıllığını müəyyən etmək istədiyimiz molekul qara rənglə göstərilmişdir. Sonra bir primerimiz var. Diqqət yetirin ki, primer 5-əsasdan 3-əsas istiqamətdə yazılmışdır. Uçlar ilkin ardıcıllıqlar və sonra şablonda primer tamamlayıcı ardıcıllıqlar olacaqdır. Beləliklə, siz adətən şablonunuzu klonlaşdıracaqsınız - bu, adi ardıcıllıqladır - ardıcıllıq üçün faj vektoru kimi bəzi vektora klonlaşdırılacaq ki, siz cinah ardıcıllıqlarını biləsiniz.

Və sonra adi Sanger ardıcıllığında dörd ardıcıllıq reaksiyası edirsiniz. Və bilirəm ki, bəziləriniz yəqin ki, əvvəllər belə halla qarşılaşmısınız. Beləliklə, ilk kimyəvi reaksiyanı götürək. DDGTP ilə burada. Bəs siz bu reaksiyaya nə qoyardınız? Məsələn, akrilonitril üzərində adi ardıcıllıq etmək istəsəniz, bu reaksiyanın bütün komponentləri hansılardır? Kimsə? Sizə nə lazımdır və bu nəyə nail olur? Hə, sənin adın nədir?

PROFESSOR: Tim? Hə, mən səni tanıyıram, Tim. Yaxşı, davam edin.

Auditoriya: Beləliklə, sizə dörd nukleotid lazımdır - deoksinukleotidlər. Dideoksi P nukleotidlərinə ehtiyacınız olacaq. Bundan əlavə, sizə bütün digər [İşitilməyən] lazımdır. Sizə polimeraza lazımdır. Ümumiyyətlə, sizə [İŞİLİLMƏYƏN] kimi bir növ bufer lazımdır.

PROFESSOR: Bəli, əsas şablon. Bəli. Əla. Bu yaxşıdır. Deyəsən, Tim həqiqətən bu təcrübəni edə bilərdi. Və hansı nisbəti qoyardınız? Beləliklə, siz dörd şərti deoksinukleotidin hamısını və sonra bir dideoksinukleotidin hamısını yerləşdirəcəyinizi söylədiniz. Burada sadəlik üçün dideoxy G deyək. Beləliklə, adi nukleotidlərlə müqayisədə dideoksinukleotidi hansı nisbətdə qoyursunuz?

Auditoriya: Konsentrasiyanı azaltmaq üçün.

PROFESSOR: Aşağı? Necə aşağıdır?

Auditoriya: Çox aşağı.

PROFESSOR: Belə bir şey. Siz onu çox aşağı qoymaq istəyirsiniz. Və niyə bu qədər vacibdir?

Auditoriya: Çünki siz istəyirsiniz ki, o şey irəliləsin. Çünki sizə kifayət qədər ribonukleotid konsentrasiyası lazımdır ki, [İŞİLİLMƏYƏN] hər bir [İŞİLİLMƏYƏN] ekvivalent və ya artıq olsun və siz [İŞİİLMƏYƏN] konsentrasiyanı dayandıracaqsınız.

PROFESSOR: Düzdür. Beləliklə, əgər siz ekvamolyar deoksi G və dideoksi G qoyursanız, şablonda hər dəfə C hərfini vurduqda xitam vermək şansı 50% olacaq. Beləliklə, ikinci G-də materialın yarısı, üçüncüsü qədər isə dörddə birinə sahib olacaqsınız və yoxa çıxacaq dərəcədə kiçik miqdarlara sahib olacaqsınız. Beləliklə, siz şablonda yalnız ilk bir neçə C-ni ardıcıllıqla sıralaya biləcəksiniz. Tam olaraq. Deməli, bu çox yaxşı məqamdır.

İndi təsəvvür edək ki, siz bu dörd ayrı reaksiyanı edirsiniz. DNT-nizi görə bilməniz üçün adətən radiolabelli primeriniz olardı. Və sonra onu bir növ gel üzərində işlədərdiniz. Bu açıq-aydın real gel deyil, ideallaşdırılmış bir versiyadır. Və sonra dideoxy G qoyduğunuz zolaqda ən kiçik məhsulları görərdiniz. Deməli, siz bu adamları aşağıdan yuxarı oxuyursunuz.

Və bu zolaqda çox kiçik bir məhsul var ki, buradakı astardan yalnız bir əsas daha uzundur. Və bu, çünki orada bir C var idi və orada dayandırıldı. Və sonra növbəti C bir neçə əsas sonra görünür. Beləliklə, burada bir növ boşluq var.

Beləliklə, şablondakı ilk bazanın T və ya C-nin tamamlayıcısı olacağını görə bilərsiniz. İkinci baza isə, bu dideoksi T zolağında növbəti ən kiçik məhsul olacaq, buna görə də A olacaq. siz sadəcə olaraq geldən yuxarıya doğru irəliləyirsiniz və ardıcıllığı oxuyursunuz. Və bu yaxşı işləyir.

Beləliklə, praktikada əslində nə kimi görünür? Burada bəzi faktiki sıralama gelləri var. Beləliklə, dörd zolaqlı qaçırsınız. Və bu kimi böyük poliakrilamid gellərində. Torbin, heç bunlardan birini idarə etmisən?

PROFESSOR: Bəli? Onları tökmək böyük bir əzabdır. Bir neçə saat qaç, məncə. Və bu bantlama nümunələrini əldə edirsiniz. Və ardıcıllığın oxu uzunluğunu nə məhdudlaşdırır? Beləliklə, biz adətən bir sequencerin bir işləməsindən yaranan ardıcıllığı oxunma adlandırırıq. Beləliklə, şablonu ardıcıllıqla sıralamaq üçün bir cəhd oxuma adlanır.

Ardıcıllığı aşağıya doğru oxumağın nisbətən asan olduğunu görə bilərsiniz və sonra yuxarı qalxdıqca çətinləşir. Beləliklə, oxu uzunluğunu əsaslı şəkildə məhdudlaşdıran şey, lentlərin bir-birinə yaxınlaşması və yaxınlaşmasıdır. Beləliklə, onlar ölçüyə tərs mütənasib olaraq kiçiklər daha sürətli işləyəcəklər. Ancaq sonra 20 əsas məhsul ilə 21 arasındakı fərq əhəmiyyətli ola bilər. Ancaq 500 əsas məhsul ilə 501 əsas məhsul arasındakı fərq çox kiçik olacaq. Beləliklə, siz daha çox zolaqlar sifariş edə bilməzsiniz. Və buna görə də, əsaslı şəkildə məhdudlaşdıran şey budur.

Yaxşı. Beləliklə, burada bir gelin dörd zolağı ilə qaçmalı olduq.Hər kəs Sanger ardıcıllığını yerinə yetirməyin daha səmərəli yolunu düşünə bilərmi? Bunu bir zolaqda etməyin bir yolu varmı? Hə, sənin adın nədir?

Auditoriya: Adrian. Dörd müxtəlif növ obyektdən istifadə edə bilərsiniz. Bəlkə də dörd fərqli rəng kimi.

Auditoriya: Dörd müxtəlif rəng. Yaxşı, buna görə də birincildə radio etiketindən istifadə etmək əvəzinə, məsələn, dideoksi obyektlərinizdə flüorofordan istifadə edirsiniz. Və sonra onları idarə edə bilərsiniz. Bu ipin harada bitdiyindən asılı olaraq, fərqli bir rəng olacaq. Və hamısını bir zolaqda idarə edə bilərsiniz. OK, belə görünür.

Beləliklə, bu, 90-cı illərdə terminator ardıcıllığı adlı mühüm inkişaf idi. Bu, 90-cı illərin sonu və 2000-ci illərin əvvəllərində həqiqətən genom ardıcıllığının işçi qüvvəsi olan ABI 3700 maşınının əsasını təşkil edirdi. Həqiqətən, insan genomunun ardıcıllığını təmin edən şey.

Və beləliklə, bu texnologiyadakı digər yeniliklərdən biri böyük bir gelə sahib olmaq əvəzinə, geli kiçiltmələri idi. Və sonra onların yalnız altında bir oxucu var idi. Beləliklə, gel bu kiçik kapilyarlar qədər incə oldu. Bilmirəm, siz bu adamları görə bilirsinizmi? Amma əslində burada kiçik bir ip kimidir. Və beləliklə, bunların hər biri effektivdir - oops! Oh yox. Narahat olma, bu dəyərli deyil. Kimdənsə pulsuz aldığım qədim texnologiya.

Beləliklə, DNT yuxarıda yüklənəcəkdir. Bunların hər birində kiçik bir gel olacaq -- buna kapilyar ardıcıllıq deyilir. Və sonra dibi tükənəcək və dörd fərqli unu aşkarlayan və ardıcıllığı oxuyan bir detektor olacaq.

Beləliklə, bu, əsasən ardıcıllıq üçün lazım olan həcmi sıxlaşdırdı. Ənənəvi ardıcıllıqla bağlı suallarınız varmı? Bəli?

Auditoriya: Flüoresan bayraqları qoyduğunuz [Eşitilməyən] haradadır? [Eşitilməyən] mövzunu bəyəndinizmi?

PROFESSOR: Bəli, yaxşı sualdır. Əslində xatırlamıram. Düşünürəm ki, müxtəlif variantlar mövcuddur. Və bəzən bu reaksiyaların bəziləri ilə bu dəyişdirilmiş nukleotidlərə dözə bilən dəyişdirilmiş polimerazalardan istifadə etməlisiniz. Bəli, mən bunu xatırlamıram. Yaxşı sualdır. Mən buna baxa bilərəm.

Beləliklə, adi sequencer nə qədər davam edə bilər? Oxuma uzunluğu nə qədərdir? Kim bilir? Təxminən 600-ə yaxındır. Və bu kifayət qədər uzun müddətdir. Tipik bir məməli mRNT nə qədərdir? Bəlkə iki, üç kb? Beləliklə, tipik bir ekzonunuz var, bəlkə də 150 ​​əsas və ya daha çox. Beləliklə, bir parçanız var. Siz ümumiyyətlə tam uzunluqlu cDNA almırsınız. Ancaq cDNT-nin bir hissəsini alırsınız, yəni üç, dörd ekzon uzunluğunda. Və bu, ümumiyyətlə, oxunan gen lokusunu unikal şəkildə müəyyən etmək üçün kifayətdir.

Və beləliklə, EST ardıcıllığının əsası idi - sözdə ifadə edilmiş ardıcıllıq etiketi ardıcıllığı. Və bu 600 əsas cDNT parçasının milyonları yaradılıb və onlar illər ərzində olduqca faydalı olublar.

Yaxşı. Beləliklə, növbəti nəsil ardıcıllığı nədir? Beləliklə, növbəti nəsil ardıcıllığında siz hər dəfə yalnız bir baza oxuyursunuz. Beləliklə, tez-tez bir az yavaş olur. Amma bu, həqiqətən də kütləvi şəkildə paraleldir. Və bu, böyük üstünlükdür. Və bu, adi ardıcıllıqla müqayisədə bazaya görə daha ucuz olan sifarişlərdir. İlk çıxanda olduğu kimi, bəlkə də iki qat daha ucuz idi. İndi yəqin ki, daha dörd böyüklük əmridir.

Əgər diqqət etdiyiniz çıxış əsasən əsasların ardıcıllığının sayı ilə mütənasibdirsə, bu, həqiqətən də ənənəvi ardıcıllığı məhv edir. Çıxış montajın keyfiyyətinə və ya başqa bir şeyə mütənasibdirsə, onda ənənəvi ardıcıllığın hələ də çox faydalı olduğu proqramlar var, çünki növbəti gen ardıcıllığı daha qısa olmağa meyllidir. Ancaq sadəcə həcm baxımından, bir reaksiyada daha çox, daha çox əsas yaradır.

Beləliklə, əsas fikirlər şablon DNT molekullarınız olmasıdır. İndi adətən, PacBio kimi texnologiyalar üçün on minlərlə və ya Illumina kimi bir növ səthdə - adətən axın hüceyrəsində - hərəkətsizləşdirilmiş texnologiyalar üçün yüz milyonlarla və şablonunuzun tək molekulunun olduğu tək molekullu üsullar var. və ya şablonunuzu yerli olaraq gücləndirən və məsələn, kiçik klasterlərdə yüzlərlə eyni nüsxə çıxaran üsullar var. Və sonra siz yüzlərlə və yüz milyonlarla şablon molekullarınızın hər birindəki növbəti bazanı sorğulamaq üçün dəyişdirilmiş nukleotidlərdən istifadə edirsiniz, çox vaxt flüoroforlar əlavə olunur.

Və beləliklə, bir neçə fərqli texnologiya var. Onların hamısı haqqında danışmayacağıq. Biz sadəcə maraqlı və geniş istifadə olunan iki və ya üç haqqında danışacağıq. Və onlar DNT şablonundan, dəyişdirilmiş nukleotidlərin hansı növlərinin istifadə olunduğundan və müəyyən dərəcədə, görüntüləmə və təsvir analizində, məsələn, klasteri ardıcıllaşdıranlardan asılı olaraq, tək molekullu üsullar üçün fərqlənir.

Beləliklə, Metzger icmalında bir cədvəl var. Beləliklə, mən sizə yeni nəsil ardıcıllığın çox ucuz olduğunu söylədim. Ancaq sonra bu maşınların nə qədər baha olduğunu görürsən və bu cür pulla çoxlu başqa maraqlı şeylər ala bilərsən. Və onu da vurğulamaq istəyirəm ki, bu, hətta tam xərc deyil. Beləliklə, əgər siz Illumina GA2 alsaydınız - bu, bir neçə il əvvəl GA2-nin ən müasir vəziyyətdə olduğu vaxta bənzəyirdi - yarım milyon dollara, bu şeyi işlətmək üçün reagentlər, əgər qaçacaqsınızsa Onu il boyu davamlı olaraq işlətmək üçün reagentlər bir milyondan çox olacaq. Beləliklə, bu, əslində dəyəri aşağı qiymətləndirir.

Bununla belə, bir bazanın dəyəri super, çox aşağıdır. Çünki onlar bir anda çoxlu məlumat yaradırlar. Yaxşı, biz bunlardan bir neçəsi haqqında danışacağıq.

Nəşr edilən və bu gün də istifadə edilən ilk növbəti nəsil ardıcıllıq texnologiyası 454-dən idi - indi Roche - və o, emulsiya PCR adlanan şeyə əsaslanırdı. Beləliklə, onlar bu kiçik muncuqlara sahibdirlər, kiçik muncuqlarda kovalent şəkildə bağlanmış adapter DNT molekulları var. Siz muncuqları DNT ilə inkubasiya edirsiniz və əslində emulsiya yaradırsınız. Beləliklə, bu, yağlı su emulsiyasıdır.

Beləliklə, hidrofilik olan hər bir muncuq yağın içindəki kiçik su qabarcığının içərisindədir. Bunun səbəbi odur ki, siz bunu kifayət qədər aşağı olan şablon konsentrasiyasında edirsiniz ki, hər muncuqla yalnız bir şablon molekulu əlaqələndirilir. Beləliklə, yağ DNT-nin bir muncuqdan digərinə keçə bilməməsi üçün bir maneə yaradır. Beləliklə, hər bir muncuq unikal şablon molekuluna sahib olacaq. Siz muncuqda həmin DNT molekulunu gücləndirmək üçün bir növ yerli PCR-ə bənzər reaksiya verirsiniz və sonra növbəti slaydda sizə göstərəcəyim lusiferaza əsaslı metoddan istifadə edərək hər dəfə bir baza ardıcıllığı edirsiniz.

Beləliklə, Illumina texnologiyası onunla fərqlənir ki, emulsiya əvəzinə siz bunu axın hüceyrəsinin səthində edirsiniz. Yenə də tək bir şablon molekulu ilə başlayırsınız. Axın hüceyrənizdə kovalent şəkildə bağlanmış bu iki növ adapter var. Şablon bu adapterlərdən birinə bağlanır. Siz adapter molekulunu dNTP və polimeraza ilə genişləndirirsiniz. İndi şablonunuzun tamamlayıcısı, denatürünüz var.

İndi sizin şablon molekulunuzun tərs tamamlayıcısı hüceyrə səthinə kovalent şəkildə bağlanır. Və sonra digər ucunda digər adapter var. Beləliklə, sizin edə biləcəyiniz şey körpü gücləndirmə adlanır, burada şablon molekulunun bu tamamlayıcısı hibridləşdirilmiş digər adapter üzərində körpü olacaq və sonra siz bu adapteri genişləndirə bilərsiniz. İndi siz orijinal şablonunuzu bərpa etdiniz. Beləliklə, indi siz tamamlayıcı ipə və orijinal ipə, denatürünüzə sahibsiniz. Və sonra bu molekulların hər biri adətən bir neçə yüz min molekuldan ibarət klasterlər yaratmaq üçün körpünün gücləndirilməsinin sonrakı dövrlərindən keçə bilər. Bu aydındır? Sual. Hə, sənin adın nədir?

Auditoriya: Stephanie. Adapterləri şablon molekullarına necə daxil edirlər?

PROFESSOR: Adapterləri şablon molekullarına necə daxil edirsiniz? Belə ki, bu adətən DNT ligasiyası ilə olur. Beləliklə, biz bunu sonrakı addımlarda əhatə edə bilərik. Bu asılıdır. Bir neçə fərqli protokol var. Beləliklə, məsələn, əgər siz mikroRNT-ləri ardıcıllıqla tərtib edirsinizsə, adətən kiçik RNT-ləri təcrid edərsiniz və adapterləri işə salmaq üçün RNT davasından istifadə edərdiniz. Və sonra DNT əldə etmək üçün RT addımı atacaqsınız.

RNT-seq və ya genom ardıcıllığı kimi əksər digər tətbiqlərlə -- beləliklə, RNT-seq ilə, siz mRNT-dən başlayırsınız, adətən ümumi RNT-ni təcrid edəcəksiniz, poli(A) seçimi aparacaqsınız, ikincil təsirlərin təsirini azaltmaq üçün RNT-ni parçalayacaqsınız. quruluşu, siz təsadüfi hexamerlər RT fermenti ilə təsadüfi baş verirsiniz. Beləliklə, cDNA 200 əsaslarının kiçik hissələri uzun olacaq. İkinci zəncir sintezindən istifadə edirsiniz. İndi ikiqat zəncirli cDNA fraqmentləriniz var. Və sonra adapterləri əlavə etmək üçün küt uc ligasyonu edirsiniz. Və sonra denatürasiya edirsiniz ki, tək bir ip olsun.

Auditoriya: Mənə elə gəlir ki, mənim sualım DNT-ni birləşdirən iki ucunun fərqli olduğuna necə əmin olmaq olar...

PROFESSOR: İki ucu fərqlidir. Bəli, yaxşı sualdır. Haqqında bəzi şeylər yazacam-- Yaxşı sualdır. Mən onu xalçanın altına süpürmək istəmirəm. Amma bir növ davam etmək istəyirəm. Və bu barədə bir az yazacam.

Yaxşı, biz 454 Illumina etdik. Helicos, tək molekul istisna olmaqla, Illumina ardıcıllığına bənzəyir. Beləliklə, şablonunuzu substratınıza kovalent şəkildə yapışdırırsınız. Siz sadəcə primeri yuyursunuz və sadəcə onun ardıcıllığına başlayırsınız. Tək molekul ardıcıllığının əsas müsbət və mənfi cəhətləri var ki, bunlar haqqında danışa bilərik.

Və sonra PacBio texnologiyası əsaslı şəkildə fərqlənir ki, şablon əslində səthə kovalent şəkildə yapışmır. DNT polimeraza kovalent şəkildə səthə bağlanır və şablon bir növ polimeraza yivlənir. Və bu, yüksək emal edən və zəncirlə yerdəyişən bir faj polimerazdır. Və şablon çox vaxt dairəvi bir molekuldur. Beləliklə, siz şablonu bir neçə dəfə oxuya bilərsiniz, bu PacBio-da həqiqətən faydalıdır, çünki ardıcıllıq üçün səhv nisbəti olduqca yüksəkdir.

Beləliklə, yuxarıda, 454-də siz lusiferaza aktivliyini ölçürsünüz - işıq. Illumina-da siz flüoresansı ölçürsünüz. Dörd fərqli flüoresan teq, Sanger ardıcıllığında gördüyümüz dörd fərqli etiket kimi. Helicose, bu, bir anda tək tag bir baza var. Və PacBio-da, həqiqətən, floresan etiketli dNTP-yə sahibsiniz və etiketi var - bu, əslində heksafosfatdır - onun altıncı fosfatda etiketi var.

Beləliklə, dNTP etiketlənir. DNT polimerazının aktiv yerinə daxil olur. Baza həqiqətən böyüyən zəncirə daxil ediləcəksə, yaşayış müddəti daha uzun olacaq. Və beləliklə, bir floresan siqnalınızın nə qədər vaxt olduğunu ölçürsünüz. Əgər uzundursa, bu o deməkdir ki, həmin baza DNT-yə daxil olmalıdır.

Lakin sonra, uzadılma reaksiyasının özü son beş fosfatı və flüorofor etiketini parçalayacaq. Beləliklə, siz doğma DNT-ni bərpa edəcəksiniz. Yəni bu başqa bir fərqdir. Halbuki Illumina ardıcıllığında, görəcəyimiz kimi, bu geri çevrilən terminator kimyası var. Beləliklə, DNT sintez etdiyiniz yerli deyil.

Beləliklə, bu, 454-də bir az daha çoxdur. Sadəcə bir neçə gözəl şəkillər. Düşünürəm ki, bunu əvvəllər təsvir etmişəm. Burada əsas kimya odur ki, hər dəfə bir dNTP əlavə edirsiniz. Beləliklə, quyuların yalnız bir alt çoxluğu - bəlkə də dörddə biri - ki, növbəti bazaya, tamamlayıcı bazaya sahibdir - primerdən sonrakı növbəti kimi - sintezə məruz qalacaq. Onlar sintez edildikdə, pirofosfat buraxırsınız.

Və onlar bu kiçik mikro muncuqlara - narıncı muncuqlara - sulfurilaza və lusiferaza ilə bağlı bu fermentlərə malikdirlər ki, onlar əsasən işıq yaratmaq üçün pirofosfatdan istifadə edirlər. Beləliklə, hər quyuda bu muncuqlardan biri var. Siz dCTP əlavə etdikdə hansı quyuların yandığına baxırsınız. Və onların növbəti baza kimi G olmalıdır və s.

Və burada heç bir xitam yoxdur. Yeganə xitam odur ki, hər dəfə yalnız bir baza əlavə edirsiniz. Beləliklə, şablonda tək bir gen varsa, bir baza əlavə edəcəksiniz. Amma şablonda iki G varsa, iki C əlavə edəcəksiniz. Və prinsipcə, iki dəfə çox işıq alacaqsınız.

Amma sonra bir növ təhlil aparmalısan ki, bizdə nə qədər işıq var? Və bir G, iki G və s. idi. Və işığın miqdarının təxminən beş və ya altı Gs-ə qədər xətti olması nəzərdə tutulur. Ancaq bu, hələ də səhvlərə daha çox meylli bir addımdır. Və 454-də ən çox yayılmış səhv növü əslində əlavələr və silinmələrdir. Halbuki Illumina sıralamasında bu, əvəzləmələrdir.

David həqiqətən məni səhvlərin ardıcıllığı və keyfiyyət balları haqqında daha çox danışmağa təşviq etdi. Və mən bir az daha çox arxa planla məşğul olmalıyam. Amma bunu bir az sonra semestrdə əlavə edə bilərəm.

Yaxşı, beləliklə, Illumina ardıcıllığında siz eyni anda bütün dörd dNTP əlavə edirsiniz. Amma onlar yerli deyillər. Onların iki əsas modifikasiyası var. Belə ki, onlar üç baş blok edirik ki,. Bu o deməkdir ki, OH pulsuz deyil, mən bir anda kimyəvi quruluşu göstərəcəyəm.

Beləliklə, birdən çox baza genişləndirə bilməzsiniz. Siz bu bazanı birləşdirirsiniz və polimeraza daha heç nə edə bilməz. Və onlar həmçinin dörd fərqli florla işarələnirlər. Beləliklə, bütün dörd dNTP-ni bir anda əlavə edirsiniz. Polimerazın onları birləşdirməsinə icazə verirsiniz. Sonra iki lazer və iki filtrdən istifadə edərək bütün axın hüceyrəsini təsvir edirsiniz.

Beləliklə, əsasən, dörd fluorun təsviri üçün. Beləliklə, axın hüceyrəsinin hər bir hissəsinin dörd fərqli şəklini çəkməlisiniz və sonra kamera hərəkət edir və siz bütün hüceyrəni skan edirsiniz. Və beləliklə, C hərfi daxil edən qruplar, deyək ki, yaşıl kanalda ləkələr kimi görünəcəklər. Və A-ya daxil olanlar və s.

Beləliklə, sizdə əsasən bu klasterlər var, onların hər biri fərqli bir şablonu təmsil edir və siz hər dəfə bir baza oxuyursunuz. Beləliklə, əvvəlcə primerdən sonra ilk bazanı oxuyursunuz. Beləliklə, şablonda aşağıya doğru sıralanır. Və siz ilk bazanı oxuyursunuz ki, bütün klasterlərinizin ilk əsasının nə olduğunu biləsiniz. Və sonra xitamını geri qaytarırsınız. Siz 3-əsas OH-ni bloklayan kimyəvi qrupu ayırırsınız ki, indi yenidən uzana bilsin. Və sonra dörd dNTP-ni yenidən əlavə edirsiniz, daha bir genişləndirmə raundunu edirsiniz, sonra yenidən təsvir edirsiniz və s.

Və buna görə də bir az vaxt lazımdır. Hər görüntüləmə təxminən bir saat çəkir. Beləliklə, 100 əsas tək və Illumina ardıcıllığı etmək istəyirsinizsə, o, təxminən dörd gün ərzində maşında işləyəcək. Üstəlik, bir gün əvvəl bir neçə saat ola biləcək klasterləri qurmaq üçün vaxt.

Bəs bu nədir? Beləliklə, əslində xitam vermənin qarşısının alınması ideyası - əsasən Sangerin ideyası - burada Illumina ardıcıllığında bir az bükülmə ilə aparılır. Və bu, ləğvi geri qaytara biləcəyinizdir. Beləliklə, aşağıya baxsanız, bunlar iki fərqli 3 əsas terminatordur. Baza hesablamanızı xatırlayın. Əsas bir, iki, üç. Beləliklə, bu, 3-əsas OH idi, indi bu metil [işitilemez] və ya hər hansı bir şey var. Mən çox kimyaçı deyiləm, ona görə də baxa bilərsiniz.

Və sonra burada başqa bir versiya var. Və bu bir növ kimyadır ki, işiniz bitdikdə bunu aradan qaldıra bilər. Və sonra burada əsasdan asılı olan bütün şey fluordur. Və siz də bunu aradan qaldırırsınız. Beləliklə, siz bu böyük mürəkkəb şeyi əlavə edirsiniz, onu təsvir edirsiniz və sonra flüoru ayırırsınız və 3 əsas bloku ayırırsınız.

Bunlar dörd kanalda təsvir edəcəyiniz bəzi real ardıcıllıq şəkilləridir. Onlar əslində ağ-qaradırlar. Bunlar psevdokoddur. Və sonra siz onları birləşdirə bilərsiniz və axın hüceyrəsindəki bütün çoxluqları görə bilərsiniz. Beləliklə, bu, bir neçə il əvvəl olduğu kimi, tövsiyə olunan klaster sıxlığına malik GA2-dəndir. İndiki vaxtda, proqram təminatı çox yaxşılaşdığından indiki görüntü, beləliklə, siz klasterləri daha sıx yükləyə və buna görə də eyni sahədən daha çox ardıcıllıq əldə edə bilərsiniz.

Ancaq bu kimi milyonlarla və milyonlarla kiçik klasterləri təsəvvür edin. Diqqət yetirin ki, klasterlərin hamısı eyni ölçüdə deyil. Əsasən, siz PCR in situ edirsiniz və buna görə də bəzi molekulları PCR ilə gücləndirmək digərlərinə nisbətən daha asandır. Və bu, ehtimal ki, ölçüdəki bu dəyişiklikləri izah edir.

Beləliklə, cari ötürmə qabiliyyəti nədir? Bu məlumatlar, bəlkə də, keçən il üçün dəqiqdir. Beləliklə, HiSeq 2000 aləti ən yüksək performanslı, geniş istifadə olunan alətdir. İndi 2500 var, amma məncə, təxminən oxşardır. Bir axın hüceyrəniz var. Beləliklə, bir axın hüceyrəsi bir növ şüşə slayd kimi görünür, ancaq bu tunellər şüşə slaydın içərisində səkkiz kiçik boru kimi oyulmuşdur. Və bu boruların səthlərində adapterlər kovalent şəkildə bağlanır. Beləliklə, səkkiz zolağınız var və bu səkkiz zolaqda səkkiz fərqli şeyi ardıcıllıqla sıralaya bilərsiniz. Birində maya genomunu edə, digərində isə RNT seqini uçura bilərsiniz və s.

Və bu günlərdə bir zolaq 200 milyon oxunuş kimi bir şey çıxaracaq. Və bu, bir zolaqdan 200 milyon oxunuş əldə etmək üçün adətən adi haldır. Bəzən daha çoxunu əldə edə bilərsiniz. 100-ə qədər baza edə bilərsiniz. Bu günlərdə miniatür versiya olan MiSeq-də 150 ​​edə bilərsiniz. Siz bəlkə 300 və ya daha çox edə bilərsiniz. Və beləliklə, bir çox ardıcıllıq var. Beləliklə, bu, bir zolaqdan 160 milyard əsas ardıcıllıqdır. Və bu, sizə başa gələcək - bu tək zolağa - harada etdiyinizdən asılı olaraq, bəlkə də 2000-3000 dollar. Və xərcə kapital xərci daxil deyil, bu, sadəcə onu idarə etmək üçün reagent dəyəridir.

Beləliklə, 160 milyard - insan genomu 3 milyarddır, buna görə də siz insan genomunu orada dəfələrlə ardıcıllıqla sıraladınız.

Daha çox şey edə bilərsiniz. Beləliklə, şablonunuzun hər iki ucunu ardıcıllıqla tərtib etdiyiniz qoşalaşmış uc ardıcıllığı edə bilərsiniz. Və bu, əldə etdiyiniz ardıcıllığın miqdarını ikiqat artıracaq. Həm də bu maşında eyni anda iki axın hüceyrəsi edə bilərsiniz. Beləliklə, siz həqiqətən bunu ikiqat artıra bilərsiniz.

Və beləliklə, bir çox tətbiq üçün 160 milyard baza həddindən artıqdır. Bu sizə lazım olduğundan daha çoxdur. Təsəvvür edin ki, bakterial genom ardıcıllığı ilə məşğul olursunuz. Bakterial genom beş meqabaza və ya daha çox ola bilər. Bu, tam həddən artıq ifratdır. Beləliklə, müxtəlif kitabxanalara kiçik altı əsas teq əlavə etdiyiniz və sonra onları bir-birinə qarışdırdığınız, maşına təqdim etdiyiniz, etiketləri birinci və ya ikinci ardıcıllıqla sıraladığınız və sonra şablonları ardıcıllıqla sıraladığınız yerdə ştrix kodlaşdırma edə bilərsiniz. Və sonra onları daha sonra effektiv şəkildə sıralayırsınız. Və sonra bir zolaqda çoxlu nümunələr edin. Və insanların ən çox etdiyi şey budur.

Beləliklə, növbəti nəsil ardıcıllıqla bağlı suallarınız varmı? Öyrənməli daha çox şey var. Bu barədə daha çox danışmaqdan məmnunam. Bu sinif üçün çox aktualdır. Amma əminəm ki, bu, Davidin bölmələrində daha sonra ortaya çıxacaq, ona görə də buna çox vaxt ayırmaq istəmirəm.

Beləliklə, indi bir Illumina alətindən və ya başqa bir alətdən oxunuşlar yaratdıqdan sonra, məsələn, mRNA-dan gələn RNT-seq xəritələmə oxuyursunuzsa, müəyyən etmək üçün onları genomla uyğunlaşdırmaq istəyəcəksiniz. onların hansı genlərdən gəldiyini bilmək istəyirlər. Beləliklə, bu oxunuşları genomla əlaqələndirməlisiniz. Ardıcıllığı uyğunlaşdırmaq istəyə biləcəyiniz bəzi başqa səbəblər hansılardır? Ümumiyyətlə, ardıcıllıqların uyğunlaşdırılması, yəni onları uyğunlaşdırmaq və uyğun gələn fərdi əsasları və ya amin turşusu qalıqlarını tapmaq niyə faydalıdır? Dieqo?

Auditoriya: İstəsəniz onları yığa bilərsiniz.

PROFESSOR: Onları yığa bilərsiniz? Bəli. Beləliklə, əgər siz genom ardıcıllığı ilə məşğul olursunuzsa, onları bir-birinə uyğunlaşdırsanız və bu şəkildə uyğunlaşan bütöv bir yığın tapsanız, daha uzun bir ardıcıllığın mövcudluğu barədə nəticə çıxara bilərsiniz. Bu yaxşı məqamdır.

Auditoriya: Julianne. Homologlara baxır.

PROFESSOR: Homoloqlara baxırıq. Sağ. Beləliklə, əgər siz, məsələn, xəstəlik geninin xəritəsini tərtib edirsinizsə, siz bir xəstəliklə əlaqəli naməlum funksiyaya malik bir insan genini müəyyən etmisiniz. Sonra onu, məsələn, siçan verilənlər bazasına qarşı axtarmaq və siçanda homolog tapmaq istəyə bilərsiniz və sonra bu, daha çox öyrənmək istədiyiniz şey ola bilər. Daha sonra siçanda onu döymək və ya mutasiya etmək və ya başqa bir şey etmək istəyə bilərsiniz. Beləliklə, bunlar bəzi yaxşı səbəblərdir. Başqaları da var.

Beləliklə, biz ilk növbədə yüksək oxşarlığın daha qısa uzantılarını tapmaq istədiyiniz uyğunlaşma növü olan yerli uyğunlaşdırma haqqında danışacağıq. Bütün ardıcıllığın hizalanmasını tələb etmirsiniz. Beləliklə, bunu etmək istəyə biləcəyiniz müəyyən vəziyyətlər var.

Beləliklə, burada bir nümunə var. Siz bu yaxınlarda kəşf edilmiş insan kodlaşdırmayan RNT-ni öyrənirsiniz. Gördüyünüz kimi, 45 bazadır. Siçan homoloqunun olub olmadığını görmək istəyirsən. Siz onu NCBI BLAST vasitəsilə idarə edirsiniz, bu da dediyimiz kimi Google axtarış motoru kimi bir növ riyaziyyatdır və siz bunu nasos dəstində etmək şansınız olacaq və buna bənzər bir zərbə alacaqsınız.

Diqqət yetirin, bu bir növ BLAST notasiyasıdır. Yuxarıda Q yazılır. Q "sorğu" üçündür, bu, daxil etdiyiniz ardıcıllıqdır. S "mövzu"dur, bu, axtarış etdiyiniz verilənlər bazasıdır. Sizin koordinatlarınız var, buna görə də 1-dən 45-ə qədər. Və sonra, mövzuda, bəzi siçan xromosomlarında və ya başqa bir şeydə 403-dən 447-ə qədər baza oldu. Və görə bilərsiniz ki, bunun bəzi uyğunluğu var. Amma onun da bəzi uyğunsuzluqları var. Beləliklə, sıralamada ümumilikdə 40 matç və beş uyğunsuzluq var.

Yəni bu əhəmiyyətlidir? Unutmayın ki, siçan genomunun uzunluğu 2,7 milyard bazadır. Bu böyükdür. Beləliklə, təsadüfən bu qədər yaxşı bir matç alacaqsınız? Beləliklə, sual həqiqətən, buna inanmalısınız? Bu, əminliklə deyə biləcəyiniz bir şeydir, bəli, siçan bir homologdur, vəssalam? Yoxsa elə olmalısan ki, yaxşı, bu mənim təsadüfən əldə etdiyimdən yaxşı deyil, buna görə də heç bir sübutum yoxdur? Yoxsa ortada bir yerdədir? Və necə deyərdiniz? Hə, sənin adın nədir?

Auditoriya: Chris. Siz hizalanma üçün bir qol funksiyasını anlamaq istərdiniz. Və sonra, bu qol funksiyası ilə əhəmiyyətli bir uyğunluğun olub olmadığını tapa bilərsiniz.

PROFESSOR: Yaxşı. Beləliklə, Chris deyir ki, siz bir qiymətləndirmə sistemi təyin etmək və sonra statistik əhəmiyyəti müəyyən etmək üçün qiymətləndirmə sistemindən istifadə etmək istəyirsiniz. Qiymətləndirmə sistemi təklif etmək istəyirsiniz? Düşünə biləcəyiniz ən sadə şey nədir?

Auditoriya: Bir uyğunluq varsa, müəyyən bir xal əlavə edirsiniz. Əgər bu uyğunsuzluqdursa, müəyyən bir balı çıxarırsınız.

PROFESSOR: Gəlin bu qiymətləndirmə sistemini edək. Beləliklə, tez-tez istifadə olunan qeyd Sii-dir. Beləliklə, bu, nukleotid i və daha sonra i nukleotidinin başqa bir nüsxəsi arasında uyğunluq olardı. Biz buna 1 üstəgəl bir matç üçün 1 zəng edəcəyik. Və sij, harada i və j fərqlidir, biz buna mənfi qiymət verəcəyik. Mənfi 1. Deməli, bu i j-ə bərabər deyil.

Beləliklə, bu, bir qol matrisidir. Bu, diaqonalda 1 və hər yerdə mənfi 1 olan dördə dörd matrisdir. Və bu adətən DNT üçün istifadə olunur. Və bundan sonra da istifadə olunan bir neçə başqa varyasyon var. Çox yaxşı, bal sistemi. Beləliklə, statistikanı necə edəcəyik? Hər hansı bir fikir? Nəyin əhəmiyyətli olduğunu necə bilirik?

Auditoriya: Yüksək xal, ehtimal ki, aşağı baldan bir az daha əhəmiyyətli olardı. Amma tərəzi, mən əmin deyiləm...

PROFESSOR: Ölçüsü o qədər də aydın deyil. Bəli, sual?

Auditoriya: Mənim adım Andreadır. Beləliklə, əgər siz RNT-ni qarışdırmısınızsa, məsələn, ardıcıllığı dəyişdirin, onda biz bu qarışdırılmış ardıcıllıqla əldə etdiyiniz [İşitilməyən] genomu əldə edəcəyik. Və xal çox əhəmiyyətli xallar haqqında qeyri-qarışıq ardıcıllıqla [İşitilemez] ilə əldə edəcəyinizlə təxminən eynidir.

PROFESSOR: Bəli, yaxşı fikirdir. BLAST, göründüyü kimi - olduqca sürətlidir. Beləliklə, siz RNT molekulunuzu qarışdıra, təsadüfi olaraq nukleotidləri dəfələrlə, bəlkə də 1000 dəfə dəyişdirə, hər birini siçan genomuna qarşı axtara və ən yaxşı nəticənin – ən yüksək xalın – paylanmasına nail ola bilərsiniz. genom, bu paylanmaya baxın və deyin ki, faktiki olanın balı həmin paylanmadan əhəmiyyətli dərəcədə yüksəkdir, yoxsa sadəcə bunun ortasında bir yerə düşür. Və bu ağlabatandır.

Bunu, şübhəsiz ki, edə bilərsiniz və bu, pis bir şey deyil. Ancaq belə çıxır ki, burada istifadə edə biləcəyiniz bir analitik nəzəriyyə var. Və beləliklə, bu qədər hesablama aparmadan əhəmiyyəti daha tez müəyyən edə biləsiniz. Və bu barədə danışacağıq. Ancaq başqa bir məsələ, statistikaya keçməzdən əvvəl, bu uyğunluğu necə tapırsınız? Bir siçan genomunda ən yüksək bal uyğunluğunu necə tapmaq olar?

Beləliklə, tutaq ki, bu oğlan sizin RNT-dir. Tamam, əlbəttə ki, biz T-lərdən istifadə edirik, lakin bu, sadəcə olaraq, siz onu DNT səviyyəsində ardıcıllıqla etdiyinizə görədir. Ancaq təsəvvür edin ki, bu sizin RNT-nizdir. Çox qısadır. Bu, məncə, 10-a yaxındır. Və bu sizin verilənlər bazanızdır. Ancaq bir neçə milyard daha davam edir. Daha bir neçə yazı lövhəsi. Və mən bu verilənlər bazasına qarşı bu sorğu ardıcıllığının ən yüksək bal seqmentini tapacaq bir alqoritm hazırlamaq istəyirəm.

Hər hansı bir fikir? Beləliklə, bu, ilk alqoritmimiz kimi olardı. Və o qədər də çətin deyil, ona görə də başlamaq yaxşıdır. Həm də tam aydın deyil. Kim bir alqoritm və ya başqa bir şey düşünə bilər, bu ardıcıllıqla müqayisədə bu ardıcıllıqla edə biləcəyimiz bəzi əməliyyatlar - hansısa şəkildə - ən yüksək xal qazanan uyğunluğu tapmağa kömək edəcək? Bağışlayın. Bəli?

Auditoriya: Siz daxil etməyi və silməyi nəzərə almalısınız.

PROFESSOR: Bəli, tamam. Beləliklə, biz bunu sadə saxlayacağıq. Bu, ümumiyyətlə, doğrudur. Amma biz bunu sadə saxlayacağıq və sadəcə əlavələr və silmələr deyəcəyik. Beləliklə, biz boşluqsuz bir yerli uyğunlaşma axtaracağıq. Beləliklə, mənim istədiyim alqoritm budur. Birincisi, boşluqlar yoxdur. Və sonra çərşənbə axşamı boşluqlar edəcəyik. Tim?

Auditoriya: Siz sadəcə olaraq bütün verilənlər bazasında [İŞİİLMƏYİCİ] ilə [İŞİLİLMƏYƏNİ] ilə müqayisə edə bilərsiniz və həmin [İŞİİLMƏYƏN] üzərindəki bütün [İŞİİLMƏYİCİ] funksiyaları söndürə və sonra [İŞİLİLMƏYƏNİ] anlaya bilərsiniz.

PROFESSOR: Bəli, tamam. Çox gözəl. Demək istəyirəm ki, bu çox düzgündür. Baxmayaraq ki, bu, həqiqətən kodlaşdırmaq istəyirsinizsə, sizə lazım olacaq qədər təsviri deyil. Məsələn, əslində bunu necə edərdiniz? Beləliklə, mən psevdokod səviyyəsində daha çox təsviri istəyirəm. Məsələn, kodunuzu necə təşkil edərdiniz.

Beləliklə, tutaq ki, hizalanmanın müxtəlif registrlərdə ola biləcəyi fərziyyəsini əyləndirdiniz. Düzəliş sorğunun birinə əsaslanaraq mövzunun birinə uyğun ola bilər. Və ya dəyişdirilə bilər. Bu, sorğunun 1-ci bazasının bu ikisinə uyğunlaşdığı uyğunlaşma ola bilər və s. Beləliklə, müxtəlif registrlər var. Beləliklə, əvvəlcə bir reyestri nəzərdən keçirək. Baza 1-in uyğun gəldiyi yer.

Beləliklə, uyğun bazalar arasındakı uyğunluqlara baxaq. Mən burada bu kiçik bucaqlı mötərizələri düzəldəcəm. İnşallah heç bir səhv etməyəcəyəm. Bunu götürəcəm. Bu, Tim-in ideyasını burada həyata keçirməkdir. Və sonra mən bunların hər birini axtaracağam - ona görə də burada aşağıya doğru getdiyini düşünün. İndi biz burada bir uyğunlaşmaya baxırıq. Bu uyğunluqdur, yoxsa uyğunsuzluq?

Bu uyğunsuzluqdur. Bu bir matçdır. Bu uyğunsuzluqdur. Bu uyğunsuzluqdur. Bu bir matçdır. Qarşılaşma Maç. Uyğunsuzluq. Uyğunsuzluq. Uyğunsuzluq. Beləliklə, sorğu ilə mövzu arasında ən yüksək xal uyğunluğu haradadır? Tim? Kimsə?

PROFESSOR: 5, 6, 7. Düzdür. Elə burada. Bir sıra üç olduğunu görə bilərsiniz. Yaxşı, bu barədə nə demək olar? Niyə bunu matça əlavə edə bilmirik? 2, 3, 4, 5, 6, 7 olmamasının səbəbi nədir?

Auditoriya: Çünki bunun üçün xal daha aşağıdır.

PROFESSOR: Çünki bunun üçün xal daha aşağıdır. Sağ. Ən yüksək bal seqmentini müəyyən etdik. Siz xəritə üzrə xalları ümumiləşdirirsiniz. Beləliklə, orada uyğunsuzluqlarınız ola bilər, lakin bunun 3 balı olacaq. Əgər bu üç əsası əlavə etmək istəsəniz, mənfi 2 və üstəgəl 1 əlavə edərdiniz, buna görə də hesabınız azalar. Beləliklə, bu daha pis olardı.

Bunu avtomatik, alqoritmik şəkildə necə etmək barədə hər hansı bir fikir varmı? Bəli? Sənin adın nədir?

Auditoriya: Simon. Beləliklə, əgər siz bütün verilənlər bazasını dəyişməyə davam etsəniz, [İşitilemez].

PROFESSOR: OK, siz onu dəyişdirməyə davam edirsiniz və bu xətlərdən birini yaradırsınız. Amma təsəvvür edin ki, mənim sorğum 1000-ə yaxın idi. Və mənim verilənlər bazam milyard kimidir. Mən bura necə baxım? Və burada ən çox qol vuran matçın nə olduğu aydın idi. Ancaq burada iki matçım olsaydı, əslində burada daha uzun bir matç keçirərdik.

Ümumiyyətlə, o ən yaxşı uyğunluğu necə tapa bilərəm? Bu registrlərin hər biri üçün, əgər istəyirsinizsə, burada 1 və mənfi 1 olan min uzun diaqonalınız olacaq. Ən yüksək bal seqmentini tapmaq üçün bu xalları necə emal edə bilərəm? Bunu etmək üçün hansı alqoritm var?

Bu, intuitiv olaraq aydındır, amma mən bir şey etmək istəyirəm, siz dəyişəni təyin edirsiniz və onu yeniləyirsiniz və ona əlavə edirsiniz və çıxarırsınız. Belə bir şey. Ancaq kompüterin həqiqətən idarə edə biləcəyi kimi. Bəli? Adınız nə idi? Julianne?

Auditoriya: Ən yüksək ümumi xalın nə olduğunu izləyə bilərsinizmi, sonra diaqonal aşağıya doğru davam edirsiniz və sonra onu yeniləyirsiniz?

PROFESSOR: Yaxşı. Ən yüksək ümumi xalın nə olduğunu izləyirsiniz?

Auditoriya: Bəli. Ən yüksək test balı.

PROFESSOR: Ən yüksək seqment balı? TAMAM. Mən bunu bura qoyacağam. Və maksimum s-i təyin edəcəyik. Bu, indiyədək əldə etdiyimiz ən yüksək seqment xalıdır. Və biz sıfıra başlamaq lazımdır, deyək. Çünki bütün uyğunsuzluqlarınız olsaydı, sıfır düzgün cavab olardı. Əgər sorğunuz A, mövzunuz isə T idisə. Və sonra nə edirsən?

Auditoriya: Diaqonaldan aşağı enərkən, izləyirsiniz...

PROFESSOR: Nəyi izləyin?

Auditoriya: Beləliklə, əvvəlcə 1-də 1-ə baxın. Sonra 2-də 1-ə gedirsən və sıfır xal tapırsan. Amma bu mənfi 1-dən yüksəkdir.

PROFESSOR: Amma o nöqtədə 2-ci bazadan sonra maksimum seqmentin balı sıfır deyil. Bu, əslində 1-dir. Çünki siz bir əsas alignment seqmentinə sahib ola bilərsiniz. Ümumi xal sıfırdır. Düşünürəm ki, siz burada bir şeylə maraqlanırsınız ki, bu da izləmək üçün faydalı ola bilər.

Gəlin məcmu hesabı edək, sonra siz mənə daha çox məlumat verin. Kumulyativ xal dəyişənini təyin edəcəyik. Biz bunu sıfıra endirəcəyik. Və sonra biz bəzi for loops olacaq, bəzi dedi ki, siz mövzu vasitəsilə loop istəyirəm. Mövzunun bütün mümkün registrləri. Belə ki, bəlkə j mövzu uzunluğu minus sorğu uzunluğu 1 bərabərdir. Belə bir şey. Bu barədə çox narahat olmayın. Yenə də bu, açıq-aydın real kod deyil. Bu psevdokoddur.

Beləliklə, bu, deyək ki, sorğu dili üçün 1 olacaq. Beləliklə, bu, diaqonalımız boyunca davam edəcəkdir. Və biz məcmu hesabı tərtib edəcəyik. Beləliklə, burada məcmu xalın j mövzu mövqeyinə uyğun gəldiyim sorğu mövqeyinin xalına bərabər olduğu bir yeniləmə əldə edəcəksiniz. Və bunu yeniləyin. Beləliklə, bu, yalnız məcmu xaldır.

Bəs o, necə görünəcək? Belə ki, bu halda, mən yalnız burada istifadə edəcəyik. Beləliklə, sıfır, 1, 2, mənfi 1, mənfi 2 var. Beləliklə, ardıcıllıqla sıfırdan başlayacaqsınız. 1-ci mövqedə siz burada mənfi 1-dəsiniz, çünki bu, uyğunsuzluq idi.

Sonra 2-ci mövqedə, dediyiniz kimi, biz sıfıra yüksəlmişik. Və sonra nə olur? Mənfi 1-ə, mənfi 2-yə enin. Sonra 1-ə çatana qədər ardıcıl olaraq üç dəfə yuxarı qalxırıq. Bundan sonra aşağı enirik.

Bəs bu məcmu hesab planında ən yüksək xal qazandığınız matç haradadır? İnsanlar 5-dən 7-yə qədər olduğunu söylədi. Bəli, sual?

Auditoriya: Beləliklə, yerli minimumdan yerli maksimuma qədər olacaqmı?

PROFESSOR: Bəli. Tam olaraq. Beləliklə, nəyi izləmək istəyirsiniz?

Auditoriya: Siz minimum və maksimumu izləmək istəyirsiniz. Fərqli olmaq üçün artırdığınız diapazonu axtarın--

PROFESSOR: Bəli, buna görə də bu, mən axtardığım daha çox şeydir - bu, yerli minimum idi və bu, yerli maksimumdur. Budur hesab. Bu sizin kütlənizdir. Və siz həm sorğuda, həm də mövzuda bunun harada baş verdiyini izləmək istəyirsiniz. Bunun mənası varmı? Beləliklə, siz bu işləyən kumulyativ xal dəyişənini izləyəcəksiniz. Son minimumu izləyirsiniz. İndiyə qədər əldə etdiyiniz minimum. Beləliklə, bu, mənfi 2-yə düşəcək.

Və sonra məcmu balınız üstəgəl 1-ə çatdıqda, siz həmişə həmin məcmu balı, sonuncu minimum kümülatif balı çıxarırsınız. Bu sizə yüksək bal toplayan seqment üçün potensial namizəd verir. Və bu, cari maksimum yüksək bal seqmentinizdən böyükdürsə, siz onu yeniləyirsiniz və bunu yeniləyirsiniz. Və sonra sizin də olduğunuz yerdə saxlayan dəyişənlər olacaq. Həm də bu son minimum harada baş verdi.

Ona görə də hər şeyi açıq-aydın yazmıram. Mən sizə bütün dəyişənləri verməyəcəyəm. Ancaq bu, maksimum balı tapacaq bir alqoritmdir. Bəli, sual?

Auditoriya: Yəni siz qlobal maksimum, yerli minimumu izləyirsiniz ki, qlobal maksimumdan sonra ən son yerli minimumu qəbul edə biləsiniz?

PROFESSOR: Mən bütün bunları əldə etdiyimə əmin deyiləm. Amma siz kumulyativ balı izləyirsiniz. Bu məcmu xalın əldə etdiyi minimum. Və maksimum fərq, keçmişdə yüksəldiyiniz maksimum. Siz yuxarıya doğru xalis artım əldə etdiyiniz yer.

Burada olduğu kimi. Beləliklə, buradakı dəyişən, bu max s, sıfıra endirilmiş olacaq. Siz bura çatanda son minimum balınız mənfi 1 olacaq. Kumulyativ balınız sıfır olacaq. Siz bunların fərqini götürərdiniz və deyərdiniz ki, oh, məndə yüksək bal seqmenti var. Mən bunu yeniləməyə gedirəm.

Beləliklə, indi bu dəyişən indi 1-dir. Sonra aşağı düşürsən, ona görə də heç nə əldə etmirsən. Siz sadəcə olaraq bu minimum kumulyativ balı burada mənfi 2-yə endirirsiniz. Və sonra bura çatanda, indi siz məcmu balı mənfi son minimumu yoxlayırsınız. Bu 1. Bu qalstukdur. Biz əlaqələri izləməyəcəyik.

İndi burada fərq 2-dir. Beləliklə, indi yeni rekordumuz var. İndi biz bu maksimum balı yerlərdə 2-yə yeniləyirik. Və sonra biz bura çatırıq, indi 3-dür və biz bunu yeniləyirik. Bunun mənası varmı?

Auditoriya: İlk enişi təsəvvür edin - mənfi 1-ə enmək əvəzinə, mənfi 3-ə endi.

PROFESSOR: Düz burada? Beləliklə, bir az geriyə başladıq. Bəs bura qayıdıb belə?

PROFESSOR: Mənfi 3-ə qədər?

PROFESSOR: Bəs mənfi 3-ə necə çata bilərik? Çünki bizim qolumuz belədir. Bu enişin mənfi 3 olmasını istəyirsiniz?

PROFESSOR: Bu bir mənfi 3? Təsəvvür edin ki, biz burada mənfi 3-dəyik?

Auditoriya: Bəli. Təsəvvür edin ki, mənfi 3-ə enib. Sonra isə ondan daha yüksək, mənfi 2-yə enib. Və sonra 1-ə yüksəldi. Beləliklə, baxdığınız fərq mənfi 2-dən 1-ə, yoxsa mənfi 3-dən 1-ə bərabər olacaq ?

PROFESSOR: Belədir, elə deyilmi? Beləliklə, mənfi 3, deyək ki, mənfi 2, 1. Belə bir şey. İnsanlar nə düşünür? Kimsə istəyir--?

PROFESSOR: Mənfi 3-dən 1-ə. Bu, heç vaxt əldə etdiyiniz minimumdur. Bu, daha güclü matç ola bilər, amma bu, daha yüksək xallı matçdır. Biz isə dedik ki, daha yüksək bal toplamaq istəyirik. Beləliklə, siz bunu sayardınız.

Auditoriya: Beləliklə, siz həm qlobal minimumu, həm də qlobal maksimumu izləyirsiniz və onlar arasındakı fərqi götürürsünüz.

PROFESSOR: Qlobal minimumu və cari kumulyativ balı izləyirsiniz və fərqi götürürsünüz.

Auditoriya: Qlobal maksimum--

PROFESSOR: Bu, mütləq qlobal maksimum deyil, çünki biz burada sıfırdan xeyli aşağı ola bilərik. Biz belə edə bilərdik. Buradan bura. Beləliklə, bu qlobal maksimum deyil. Bu, sadəcə olaraq baş verir, biz son minimumumuzdan bəri çox yüksəldik. Beləliklə, bu, yüksək bal toplayan seqmentinizdir. Bunun mənası varmı?

Mən bunu tam təfsir etməmişəm. Amma mən hesab edirəm ki, siz burada kifayət qədər fikir vermisiniz ki, bir növ alqoritmin əsası var. Mən sizə bunu daha sonra düşünməyinizi və suallarınız varsa mənə bildirməyinizi tövsiyə edirəm. Və biz isteğe bağlı ev tapşırığı əlavə edə bilərik ki, sizdən bunu etməyi xahiş edirəm, biz bəzən keçmişdə etdik. Baxmaq üçün faydalı bir şeydir.

BLAST alqoritmi tam olaraq belə işləmir. Daha sürətli sürət üçün bəzi fəndlərdən istifadə edir. Ancaq bu, eyni böyüklükdə işləmə müddətinə sahib olması mənasında BLAST-a mənəvi cəhətdən bərabərdir.

Belə ki, bu alqoritm-- Big-O notation çalışan vaxt nədir? Beləliklə, yalnız CS olmayan insanlar üçün, bu Big-O notasiyasından istifadə etdiyiniz zaman soruşursunuz, girişin ölçüsündə işləmə müddəti necə artır? Və beləliklə, giriş nədir? Beləliklə, iki girişimiz var. Uzunluqlu bir sorğumuz var. Və tutaq ki, n uzunluğunda mövzu. Aydındır ki, onlar daha böyükdürsə, işləmək daha uzun sürəcək. Ancaq müxtəlif alqoritmləri müqayisə edərkən, işləmə vaxtının bu uzunluqlardan necə asılı olduğunu bilmək istəyirsən. Bəli. Sənin adın nədir?

PROFESSOR: Beləliklə, bu, sifariş mn alqoritmi adlandırdığınız şeydir. Və niyə belədir? Bunu necə görmək olar?

Auditoriya: Sizdə iki for loop var Və hər bir uzunluq üçün, mahiyyətcə, sorğuda hər şeyi keçirsiniz. Və sonra, sorğuda keçdiyiniz hər şey üçün [İşitilməyəcəksiniz].

PROFESSOR: Düzdür. Bu ikinci for loopda siz sorğudan keçirsiniz. Və siz bunu edirik ki, içəridə yuvalanmış for loop ki, əsasən mövzu uzunluğu. Və nəhayət, sorğudakı hər bazanı mövzudakı hər baza ilə müqayisə etməli olacaqsınız. Bundan çıxış yolu yoxdur. Və bu müəyyən vaxt vahidini tələb edir. Beləliklə, faktiki vaxt buna mütənasib olacaq. Beləliklə, n nə qədər böyük olarsa və m olarsa, bu, məhsula mütənasibdir. Bunun mənası varmı?

Və ya bu barədə düşünməyin başqa bir yolu budur ki, bu diaqonalda bir şey etməli olacaqsınız. Və sonra bu diaqonalda bir şey etməli olacaqsınız, və bu, və bu. Və əslində, burada bunları da yoxlamaq lazımdır. Və sonda, hesablamaların ümumi sayı bu dəfə olacaq. Siz əsasən düzbucaqlı dəyərində hesablamalar edirsiniz. Bunun mənası varmı?

Yəni bu pis deyil, elə deyilmi? Daha pis ola bilər. Bu, mn kvadratı və ya buna bənzər bir şey ola bilər. Buna görə də BLAST sürətlidir.

Bəs, ümumiyyətlə, bunlar nə kimi görünür? Və bu alqoritmin işləməsi üçün xalımızda hansı şərt var? Bir matça üstəgəl 1, uyğunsuzluğa isə sıfır qoysam nə olar? Bunu edə bilərdikmi? Joe, başını bulayırsan.

Auditoriya: Bu, sadəcə olaraq yüksələcək.

PROFESSOR: Bəli. Problem ondadır ki, bir müddət düz ola bilər, amma sonda yüksələcək. Və o, yalnız yuxarı və yuxarı qalxacaqdı. Və beləliklə, ən yüksək bal toplayan seqmentiniz, çox vaxt başlanğıca çox yaxın başlayan və sona yaxın bitən bir şey olardı. Yəni bu işləmir. Belə ki, xalis mənfi sürüşmə olmalıdır. Və rəsmiləşdirilən yol budur ki, gözlənilən xal mənfi olmalıdır.

Bəs nə üçün matç üçün üstəgəl 1, uyğunsuzluq üçün mənfi 1 olan bu bal sistemində gözlənilən xal mənfi olur? Bu niyə işləyir?

Auditoriya: Zamanın dörddə üçü səhv olmalıdır.

PROFESSOR: Bəli. Vaxtın dörddə üçündə uyğunsuzluq yaşayacaqsınız. Beləliklə, orta hesabla aşağı sürüşməyə meyllisiniz.Və sonra yuxarıya doğru bu kiçik ekskursiyalarınız var və bunlar sizin yüksək bal toplayan seqmentlərinizdir. Bununla bağlı sualınız varmı?

Auditoriya: Sual. m çarpı n-dən daha yaxşı bir şey varmı?

PROFESSOR: Bizim burada bir neçə kompüter alimi var. David? m dəfə n-dən yaxşıdır? Mən belə düşünmürəm, çünki bütün bu müqayisələri etməlisən. Və buna görə də bunun ətrafında heç bir yol yoxdur, ona görə də belə düşünmürəm. Yaxşı. Amma daimi - siz bu alqoritmdən daha sabitdə daha yaxşısını edə bilərsiniz.

Auditoriya: Çoxsaylı sorğularla--

PROFESSOR: Çoxlu sorğularla, bəli. Onda siz bəlkə bir az hashing edə bilərsiniz və ya onu sürətləndirmək üçün tapa bilərsiniz.

Yaxşı, bəs bunun statistikası haqqında nə demək olar? Belə çıxır ki, Karlin və Altşul məhz bu problem üçün hansısa nəzəriyyə işləyib hazırlamışlar. Sorğu ardıcıllığını axtarmaq üçün. Tam xallarınız olduqda və orta və ya gözlənilən xal mənfi olduqda, bu, nukleotid və ya zülal ola bilər, onda bu nəzəriyyə sizə bütün sorğu verilənlər bazası müqayisəsi üzrə ən yüksək xalın nə qədər tez-tez olduğunu söyləyir. BLAST kimi yerli uyğunlaşdırma alqoritmindən istifadə edərək x-i kəsin.

Və belə çıxır ki, bu ballar ekstremal dəyər və ya Gumbel paylanması adlanan şeyə uyğundur. Və burada bu cür ikiqat eksponensial formaya malikdir. Beləliklə, x bir qədər kəsilmişdir. Beləliklə, adətən x, sorğunuzu verilənlər bazasında axtardığınız zaman həqiqətən müşahidə etdiyiniz xal olacaqdır. Sizi maraqlandıran budur.

Və sonra bilmək istəyirsən ki, bundan daha yüksək bir şey görməyimiz ehtimalı nə qədərdir? Və ya edə bilərsiniz ki, x müşahidə etdiyiniz baldan bir azdır. Beləliklə, bizim eyni şeyi müşahidə etmə şansımız nədir, bu qədər yaxşı və ya daha yaxşı? Bunun mənası varmı? Beləliklə, bu sizin P dəyəriniz olacaq.

Beləliklə, S ehtimalı. Eyni uzunluqlu təsadüfi verilənlər bazasına qarşı təsadüfi sorğunuzun olduğu model altında ən yüksək seqmentin balı 1 minus e-dən mənfi KMN e-dən mənfi lambda x-ə bərabərdir. Burada M və N sorğunun və verilənlər bazasının uzunluqlarıdır. x xaldır. Və sonra K və lambda iki müsbət parametrdir ki, əslində sizin xal matrisinin təfərrüatlarından və ardıcıllıqlarınızın tərkibindən asılıdır.

Və belə çıxır ki, lambda həqiqətən vacib olandır. Və bunu görə bilərsiniz, çünki lambda x-i vuran eksponentdə yuxarıdadır. Beləliklə, əgər lambdanı ikiqat artırsanız, bu, cavaba böyük təsir göstərəcək. Və K, belə çıxır ki, əksər məqsədlər üçün ona məhəl qoymamaq olar.

Beləliklə, bir düstur olaraq, bu şey nə kimi görünür? Belə görünür. Bir növ gülməli forma. Bir az umlauf kimi görünür, lakin sonra sağda soldan fərqli bir forma var. Və bu lambdanı necə hesablayırsınız? Beləliklə, mən dedim ki, lambda bütün bunların açarıdır, çünki bu düsturdakı unikal vacib yerə görə, xalları çoxaldır.

Belə çıxır ki, lambda burada bu tənliyin unikal müsbət həllidir. Beləliklə, indi əslində qol matrisindən asılıdır. Yəni görürsən ki, orada sij var. Bu, sorğunun tərkibindən asılıdır. Bu, pidir. Mövzünüzün tərkibi, bu rj-nindir. Siz dörd nukleotidin hər birinə bərabər olan i və j üzərində cəm edirsiniz. Və bu məbləğ 1 olmalıdır. Beləliklə, bu tənliyin unikal müsbət həlli var.

Beləliklə, belə bir tənliyi necə həll edə bilərik? Əvvəla, bu necə bir tənlikdir, nəzərə alsaq ki, biz sij təyin edəcəyik və biz sadəcə pi və rj-i ölçəcəyik? Beləliklə, bunların hamısı məlum sabitlərdir və lambda burada həll etməyə çalışdığımız şeydir. Bəs lambdada bu necə bir tənlikdir? Xətti? Kvadrat? Hiperbolik? Bunun nə olduğunu bilən varmı?

Beləliklə, bu, transsendental tənlik adlanır, çünki siz müxtəlif güclərə maliksiniz. Bu, bir növ xoşagəlməz səslənir. Çox güman ki, transsendental tənliklərdə dərs almırsınız. Beləliklə, ümumiyyətlə, mürəkkəbləşdikdə analitik şəkildə həll etmək mümkün deyil. Ancaq sadə hallarda onları analitik şəkildə həll edə bilərsiniz. Və əslində, gəlin yalnız birini edək.

Beləliklə, ən sadə halı götürək, o olardı ki, bütün pi-lər dörddə birdir. Bütün ri-lər dörddə birdir. Və biz daha əvvəl hazırladığımız qiymətləndirmə sistemindən istifadə edəcəyik, burada sii 1, sij isə mənfi 1-dir. Əgər i j-ə bərabər deyilsə.

Və biz onları orada həmin məbləğə bağlayanda nə əldə edirik? Lambdaya dörddə bir, dörddə bir, e çarpı olan dörd şərt alacağıq. Dörd mümkün uyğunlaşma növü var, elə deyilmi? Onların dörddə bir dəfə ehtimalı var. Bu pi və rj. Və lambda sii üçün e yalnız lambda üçün e-dir, çünki sii 1-dir. Və sonra 12 şərt var ki, dörddə bir, dörddə bir, e mənfi lambda. Çünki mənfi 1 hesab var. Və bu 1-ə bərabər olmalıdır.

Odur ki, bunu ləğv et, bəlkə 4-ə vuracağıq. Beləliklə, indi biz lambda üstəgəl 3 alırıq. e-dən mənfi lambda 1-ə bərabərdir. Bu, hələ də transsendental tənlikdir, lakin bir az daha sadə görünür. Bunu lambda üçün necə həll etmək barədə hər hansı bir fikir var? Sally?

Auditoriya: 1 4 olmazmı?

PROFESSOR: Bağışlayın. 4. Təşəkkür edirəm. Hə, sənin adın nədir?

Auditoriya: [İşitilməz] Mən hesab edirəm ki, [İşitilməyən] kvadrat tənlik. Əgər hər iki tərəfi [İŞİLİLMƏYƏN] ilə çarparsanız, [İŞİLİLMƏYƏN].

PROFESSOR: Yaxşı, buna görə də iddia budur ki, bu, əsasən kvadratik tənlikdir. Beləliklə, hər iki tərəfi lambdaya e ilə vurursunuz. Belə ki, sonra e almaq 2 lambda plus 3. Və sonra bu üzərində hərəkət etmək olacaq və mənfi 4 e lambda sıfıra bərabərdir. Bu yaxşıdır?

Beləliklə, bu necə kvadratdır? Bunu həll etmək üçün əslində nə edirsiniz?

PROFESSOR: Dəyişən dəyişdirin, x lambdaya bərabərdir. Sonra x-də kvadratdır. x üçün həll edin. Kvadrat tənlikləri necə həll edəcəyimizi hamımız bilirik. Və sonra bunu lambda ilə əvəz edin. Yaxşı, hamı bunu anladı?

Bütün müxtəlif növ uyğunlaşmaları və uyğunsuzluğu təmsil etmək üçün 16 fərqli xaldan istifadə etsəniz, bu, çox xoşagəlməz olacaq. Bu həll olunmaz deyil, sadəcə onu həll etmək üçün hesablama ədədi üsullardan istifadə etməlisiniz. Ancaq sadə hallarda bir neçə fərqli xalınız varsa, bu, çox vaxt kvadrat tənlik olacaqdır.

Yaxşı. Tutaq ki, bizdə xüsusi bir qiymətləndirmə sistemi var - xüsusi pi, rj-- və biz onları qane edən lambda dəyərimiz var. Beləliklə, biz lambda üçün bu kvadrat tənliyi həll etdik. Düşünürəm ki, lambda təbii log 3-ə bərabərdir, buna bənzər bir şey əldə edirik. Unutmayın, bu unikal müsbət həlldir. Kvadrat tənliklər iki həll yoludur, lakin yalnız bir müsbət həll olacaq. Və sonra biz bu dəyərə sahibik. Bu tənliyi təmin edir.

Bəs onda xalları ikiqat artırsaq nə olacaq? Plyus 1 minus 1 əvəzinə üstəgəl 2 minus 2 istifadə edirik? Onda nə olacaqdı? Lambdanın orijinal versiyasının hələ də bu tənliyi təmin etməyəcəyini görə bilərsiniz. Ancaq bir az düşünsəniz, lambdanın hansı yeni dəyərinin bu tənliyi təmin edəcəyini anlaya bilərsiniz.

Bu xallarla həll edən lambda üçün həll etdik. İndi yeni xallarımız olacaq. sii əsas bərabərdir 2. sij əsas bərabərdir mənfi 2. Lambda əsas nədir? Bu ballarla gedən lambda? Bəli, davam edin.

Auditoriya: Orijinalın yarısı?

PROFESSOR: Orijinalın yarısı? Sağ. Beləliklə, siz deyirsiniz ki, lambda əsas 2-dən çox lambdaya bərabərdir. Və niyə belədir? İzah edə bilərsən?

Auditoriya: [Eşitilməyən] səbəbiylə.

PROFESSOR: Bəli, bu şərtləri cəmi ilə düşünsəniz, s hissəsi ikiqat artır. Beləliklə, lambdanı kəssəniz və məhsul əvvəllər etdiyinə bərabər olacaqdır. Biz pi və rj-ləri dəyişməmişik, ona görə də bütün bu şərtlər eyni olacaq. Beləliklə, yenə də bu tənliyi təmin edəcəkdir. Beləliklə, bu barədə düşünməyin başqa bir yolu. Bəli, düz deyirsiniz.

Beləliklə, siz xalları iki dəfə artırsanız, lambda 2 dəfə azalacaq. Bəs bu, lambda haqqında nə deyir? Bu nədir? Onun mənası nədir? Bəli, davam et, Jeff.

Auditoriya: Gözlənilən bala görə bölgü miqyası? Yoxsa diapazon balı?

PROFESSOR: Bəli. Əsasən balları ölçür. Beləliklə, biz eyni tənliyi burada ixtiyari hesabla istifadə edə bilərik. Sadəcə onu miqyaslandırır. Hesabın qarşısında çarpan amil kimi necə göründüyünü görə bilərsiniz. Beləliklə, bütün xalları ikiqat artırsanız, bu, ən yüksək bal toplayan seqmentin nə olduğunu dəyişəcəkmi? Xeyr, bu onu dəyişməyəcək, çünki sizdə bu məcmu şey olacaq. Sadəcə y oxunu necə etiketlədiyinizi dəyişir. Onu böyüdəcək, amma nə olduğunu dəyişməyəcək.

Və bu tənliyə baxsanız, statistik əhəmiyyəti dəyişməyəcək. X ikiqat dəyər qazanacaq, çünki bütün matçlar indi əvvəlkindən iki dəfə bahadır. Lakin lambda yarısı böyük olacaq və buna görə də məhsul eyni olacaq və buna görə də son ehtimal eyni olacaq. Beləliklə, bu, müxtəlif qiymətləndirmə sistemlərindən istifadə etmək üçün sadəcə miqyaslı amildir. Hamı bunu anladı?

Yaxşı. Beləliklə, DNT üçün hansı skorlama matrisindən istifadə etməliyik? Buna nə deyirsən? Beləliklə, bu, indi kiçik bir ümumiləşdirmədir. Beləliklə, matçlar üçün 1-i saxlayacağıq. Matçlar üçün burada 1-i seçməklə heç bir ümumiliyi itirmirsiniz, çünki 2 istifadə etsəniz, lambda kompensasiya etmək üçün sadəcə azalacaq.

Beləliklə, matçlar üçün 1. Və sonra uyğunsuzluqlar üçün m-dən istifadə edəcəyik. Və bu nəzəriyyənin işləməsi üçün bu şərti təmin etmək üçün m mənfi olmalıdır ki, orta bal mənfi olmalıdır. Aydındır ki, bəzi mənfi xallarınız olmalıdır.

Və sual budur ki, əvvəllər istifadə etdiyimiz kimi mənfi 1 istifadə etməliyik? Yoxsa mənfi 2 və ya mənfi 5 və ya başqa bir şey kimi istifadə etməliyik? Bu barədə hər hansı bir fikriniz varmı? Yoxsa fərqi var? Bəlkə də fərqi yoxdur. Hə, sənin adın nədir?

Auditoriya: [Eşitilməz]. [EŞİLMƏYƏN] üçün istifadə etməməyin mənası varmı?

PROFESSOR: Bəli, tamam. Beləliklə, daha mürəkkəb bir qiymətləndirmə sistemindən istifadə etmək istəyirsiniz. Hansı uyğunsuzluqları daha çox və daha az cəzalandırmaq istərdiniz?

Auditoriya: [İşitilməz] Düşünürəm ki, [İşitilməyən] [İşitilməyən] olmalıdır.

PROFESSOR: Bəli, intuisiyanızda haqlısınız. Bəlkə bioloqlardan biri burada bir təklif vermək istəyir. Bəli, davam edin.

Auditoriya: Deməli, bu purin və pirimidin arasında uyğunsuzluqdur [İşitilmir].

PROFESSOR: Yaxşı, indi purinlər və pirimidinlər var. Beləliklə, hamı xatırlayır, purinlər A və G-dir. Pirimidinlər C və T-dir. Və fikir ondan ibarətdir ki, bu cəzalandırılmalıdır və ya bu, purin pirimidinə dəyişdirməkdən daha az cəzalandırılmalıdır. Və niyə bunun mənası var?

Auditoriya: Yaxşı, struktur olaraq onlar...

PROFESSOR: Struktur olaraq, purinlər pirimidinlərdən daha çox bir-birinə bənzəyir. Bəs? Daha önəmlisi, məncə. Təkamüldə?

PROFESSOR: Bağışlayın, danışa bilərsinizmi?

Auditoriya: C-dən C-yə qədər mutasiyalar [İşitilməyən] kimyada kortəbii olaraq baş verir.

PROFESSOR: Bəli. Beləliklə, C-C mutasiyaları kortəbii olaraq baş verir. Beləliklə, əsasən, daha asandır, çünki struktur olaraq daha oxşar görünürlər. DNT polimerazının səhv etmək və başqa purinlə əvəz etmək ehtimalı daha yüksəkdir. Purin, purin və ya pirimidin, pirimidin növünü dəyişən transversiyalara nisbəti müxtəlif sistemlərdə təxminən üçdən birə və ya ikiyə birdir. Bəli, bu yaxşı fikirdir.

Ancaq sadəlik üçün, sadəcə riyaziyyatı sadə saxlamaq üçün, biz sadəcə bir uyğunsuzluq cəzası ilə gedəcəyik. Amma bu yaxşı məqamdır. Praktikada bunu etmək istəyə bilərsiniz.

Beləliklə, indi deyirəm ki, sizi bir uyğunsuzluq cəzası ilə məhdudlaşdıracağam. Amma mən sizə istədiyiniz dəyəri seçməyə icazə verəcəm. Beləliklə, hansı dəyəri seçməlisiniz? Yoxsa fərqi var? Və ya bəlkə fərqli proqramlar? Tim, hə?

Auditoriya: Mənim bir sualım var. Bu, pi və ri-dən asılıdır? Məsələn, bütün bu rəqəmlərdən istifadə edə bilərik. Amma ümumi mənfi olmaq istəyirsə, onda siz mənfi .1 istifadə edə bilməzsiniz.

PROFESSOR: Düzdür, yaxşı məqamdır. Siz onu çox zəif edə bilməzsiniz. Bu, əslində pi və ri-dən asılı olan matçların gözlənilən hissəsinin nə olduğundan asılı ola bilər. Beləliklə, çox AT zəngin kimi çox qərəzli ardıcıllığınız varsa, matçların gözlənilən hissəsi əslində daha yüksəkdir. Zəngin AT ardıcıllığını başqa bir AT zəngin ardıcıllığına qarşı tədqiq edərkən, əslində dörddə birdən yüksəkdir.

Belə ki, hətta mənfi bir də orada kifayət olmaya bilər. Sizə daha çox mənfi yanaşmanız lazım ola bilər. Beləliklə, gözlənilən dəyərin mənfi olduğundan əmin olmaq üçün daha yüksək mənfi dəyərdən istifadə etməlisiniz. Düzdür. Bəli, siz onu tərkibə əsasən tənzimləmək istəyə bilərsiniz.

Beləliklə, bir az daha çox şey edək. Beləliklə, məlum olur ki, Karlin və Altşul nəzəriyyəsi sizə uyğunluğunuz üçün p dəyərinin nə olduğunu - statistik əhəmiyyətini - izah etməklə yanaşı, eynilik nisbətinin hansı hissəsinə sahib olacaqları baxımından uyğunluqların necə görünəcəyini də izah edir. var. Və bu sözdə hədəf tezlik tənliyidir.

Nəzəriyyə deyir ki, əgər mən bir xüsusi kompozisiya ilə sorğu axtarsam, p, mövzu meta-kompozisiya r-- burada, mən onların eyni olduğunu fərz etdim, hər ikisi də sadəlik üçün p-- hesablama matrisi sij ilə. lambda uyğunluğu var. Sonra, çox yüksək xal toplayan matçları götürəndə - statistik cəhətdən əhəmiyyətli olanları - və bu uyğunlaşmaların uyğunlaşdırılmasına baxdıqda, bu düsturla verilən qij dəyərlərini alacağam.

Beləliklə, formulaya baxın. Belə ki, qij var. Beləliklə, lambda sij üçün pipj e. Beləliklə, təsadüfən j əsaslı i bazasına uyğunlaşmağın gözlənilən şansı var. Bu pipj. Lakin sonra lambda sij üçün e ilə çəkildi. Beləliklə, bir matç üçün qeyd edirik, s müsbət olacaq, buna görə də lambdaya e müsbət olacaq. Beləliklə, bu, 1-dən böyük olacaq. Sizdə daha çox uyğunluq olacaq və uyğunsuzluğun mənfi olduğu üçün daha az uyğunsuzluq olacaq. Beləliklə, hədəf dəyər xalını əldə edin.

Və bu da sizə deyir ki, təbii xallar deyilən xallar həqiqətən yüksək bal seqmentlərində istədiyiniz matçların hissəsi ilə müəyyən edilir. Əgər 90% uyğunluq istəyiriksə, biz sadəcə qii-ni 0,9 olaraq təyin edirik və bu tənliyi burada istifadə edirik. Sij üçün həll edin.

Məsələn, R% şəxsiyyətləri olan bölgələri tapmaq istəyirsinizsə. Kiçik r yalnız bir nisbət olaraq r-dir. qii r üzərində 4 olacaq. Bu, qərəzsiz baza tərkibini nəzərdə tutur. Matçların dörddə biri acgtdır. Beləliklə, Qij 12-dən 1 minus r-dir. 1 minus r uyğun olmayan mövqelərin bir hissəsidir. Onlar 12 müxtəlif növdür.

Sii-ni 1-ə bərabər qoyun, biz normal olaraq etdiyimizi dedik. Və sonra burada bir az cəbr edirsən. m sijdir. Və siz bu tənliyi burada iki dəfə daxil edirsiniz. Və bu tənliyi alırsınız. Beləliklə, deyir ki, m log 4 1 minus r üzərində 3 üzərində log 4 r-ə bərabərdir.

Və bunun doğru olması üçün bu, həm sorğunun, həm də verilənlər bazasının dörddəbir vahid tərkibə malik olduğunu və r-nin dörddəbirdən 1-ə qədər olduğunu nəzərdə tutur. Yüksək xal toplayan seqmentinizdə uyğunluqların nisbəti-- siz onun daha böyük olmasını istəyirsiniz. dörddə birindən çoxdur. Dörddə biri təsadüfən görəcəyiniz şeydir. Onların əhəmiyyətli olduğunu düşünürsünüzsə, qiymətləndirmə sisteminizdə səhv bir şey var. Yəni 25%-dən yuxarı bir şeydir.

Və bu, sadəcə sadə cəbr-- siz evdə mənim işimi yoxlaya bilərsiniz - burada m-ni həll etmək üçün. Və sonra bu tənlik sizə deyir ki, əgər mən nukleotid axtarışında 75% eyni uyğunluq tapmaq istəsəm, mənfi 1 uyğunsuzluq cəzasından istifadə etməliyəm.

Əgər mən 99% eyni matçlar istəsəm, mənfi 3 penaltidən istifadə etməliyəm. Mənfi 5 yox, mənfi 3. Və bu barədə düşünməyinizi istəyirəm, bunun mənası varmı? Bunun mənası yoxdur? Çərşənbə axşamı dərsin əvvəlində sizdən daha yüksək faiz identifikasiyası istədiyiniz zaman daha mənfi uyğunsuzluq balı istəməyinizə dair bu xüsusi fenomeni izah etməyinizi və şərh etməyinizi xahiş edəcəyəm. Son sualınız varmı? Şərhlər?


Bu Geni Adlandırın

Məqsəd: Bu fəaliyyətdə siz DNT nümunəsindən əsasların ardıcıllığını müəyyən etmək üçün Milli Biotexnologiya Məlumat Mərkəzinin internet saytından istifadə edəcəksiniz.

Ümumi məlumat: NCBI sıralanmış və identifikasiya edilmiş genlərin məlumat bazasını ehtiva edir. Bir sıra alimlərin işi və müxtəlif sahələr bu məlumat bazasında məlumatların yığılmasına imkan verir. Bu fəaliyyətdə istifadə edilən alət istifadəçiyə DNT əsaslarının ardıcıllığını (A, T, G, C) axtarış sisteminə təqdim etməyə imkan verən BLAST - Basic Logical Alignment Search Tool-dur, BLAST verilənlər bazasında axtarış aparacaq və geni tapacaq ( varsa) həmin ardıcıllıqla əlaqələndirilir. Bundan əlavə, istifadəçi gen və ya səbəb olduğu xəstəlik haqqında məlumat əldə edə bilər.

Təlimatlar

Sizə mutasiyaya uğradıqda genetik xəstəliklə əlaqəli real insan DNT-sində tapılan nukleotid ardıcıllığı veriləcək. Sizin işiniz genetik verilənlər bazalarını axtarmaq üçün BLAST alətindən istifadə edərək sizə verilən ardıcıllığı ən çox tanınan genlərin nukleotid ardıcıllığı ilə müqayisə etməkdir. Testlərinizi həyata keçirərkən bu pəncərəni açıq saxlayın, bu, gen ardıcıllığını kopyalayıb yapışdırmağı asanlaşdıracaq.

1. NCBI üçün əsas səhifəyə keçin ( www.ncbi.nlm.nih.gov)
2. "populyar resurslar" altında yerləşən "BLAST" sözünün üzərinə klikləyin
3. "Nucleotide BLAST" üzərinə klikləyin
4, Aşağıdakı nukleotid ardıcıllığından birini kopyalayın və yuxarı qutuya yapışdırın. Əsasən, proqram bütün məlum ardıcıllıqlardan keçəcək və uyğunluq tapacaq. Serverin nə qədər məşğul olmasından asılı olaraq, bu bir müddət çəkə bilər.
5. Ən yaxın uyğunluq qısa təsviri ilə göstəriləcək, ardıcıllığınız haqqında ətraflı məlumat üçün GENE linkinə klikləyin. Bu, ardıcıllığınıza uyğun gələn genin təsvirini verəcəkdir.

Təhlil: Ayrı bir səhifədə (və ya çap edilmiş və çap edilmiş) aşağıdakı ardıcıllıqla əlaqəli genlərin hər birini müəyyən edin. Geni və onun insan və bioloji tədqiqatlar üçün əhəmiyyətini təsvir edən qısa xülasə yazın.

ATG GCG GGT CTG ACG GCG GCG GCC CCG CGG CCC GGA GTC CTC CTG CTC CTG CTG TCC ATC CTC CAC
CCC TCT CGG CCT GGA GGG GTC CCT GGG GCC ATT CCT GGT GGA GTT CCT GGA GGA GTC TT

ATG CTC ACA TTC ATG GCC TCT GAC AGC GAG GAA GAA GTG TGT GAT GAG CGG ACG TCC CTA ATG TCG
GCC GAG AGC CCC AGC CCG CGC TCC TGC CAG GAG GGC AGG CAG GGC CCA GAG GAT GGA G

ATG TTT TAT ACA GGT GTA GCC TGT AAG AGA TGA AGC CTG GTA TTT ATA GAA ATT GAC TTA TTT TAT
TCT CAT ATT TAC ATG TGC ATA ATT TTC CAT ATG CCA GAA AAG TTG AAT AGT ATC AGA TTC CAA ATC T

ATG CGT CGA GGG CGT CTG CTG GAG ATC GCC CTG GGA TTT ACC GTG CTT TTA GCG TCC TAC ACG AGC
CAT GGG GCG GAC GCC AAT TTG GAG GCT GGG AAC GTG AAG GAA ACC AGA GCC AGT CGG GCC

ATG CCG CCC AAA ACC CCC CGA AAA ACG GCC GCC ACC GCC GCC GCT GCC GCC GCG GAA CCC GGC ACC
GCC GCC GCC GCC CCC TCC TGA GGG ACC CAG AGC AGG ACA GCG GCC CGG AGG AC

ATG TTG TGCAAT ATC CAT CTA CTG TAG TTA AGA TAT TCA GTA GTT TGT TTT TCA TAA GCA TGT AAT
TGA TCA TAT TTC TGC CAA GGA TGT GCC TTC AAC TTT ATA ATT ATA GTG TTG TAA AAT ATT TTT GTC TG

ATG CCA TCT TCC TTG ATG TTG GAG GTA CCT GCT CTG GCA GAT TTC AAC CGG GCT TGG ACA GAA
CTT ACC GAC TGG CTT TCT CTG CTT GAT CAA GTT ATA AAA TCA CAG AGG GTG ATG GTG GGT GAC CTT

/>Bu iş Creative Commons Attribution-NonCommercial-ShareAlike 4.0 Beynəlxalq Lisenziyası əsasında lisenziyalaşdırılıb.


9.7: BLASTP alqoritmi

  • Clare M. O&rsquoConnor tərəfindən töhfə
  • Boston Kollecində fəxri dosent (biologiya).

BLASTP-də sorğu ardıcıllığı hərəkət edən pəncərədən istifadə edərək bütün mümkün 3 hərfli sözlərə bölünür. BLOSUM62 matrisindən amin turşularının dəyərlərini əlavə etməklə hər bir söz üçün ədədi xal hesablanır. 12 daha çox bal toplayan sözlər, yəni. daha yüksək dərəcədə qorunan amin turşuları olan sözlər ilkin BLASTP axtarış dəstinə toplanır. BLASTP daha sonra bir mövqedə olan sözlərdən fərqli sinonimlər əlavə etməklə axtarış dəstini genişləndirir. Axtarış dəstinə yalnız həddən artıq xalları olan sinonimlər əlavə edilir. NCBI BLASTP sinonimlər üçün standart 10 həddi istifadə edir, lakin bu, istifadəçi tərəfindən tənzimlənə bilər. Bu axtarış dəstindən istifadə edərək, BLAST sürətlə verilənlər bazasını skan edir və axtarış dəstindən iki və ya daha çox söz/sinonim olan zülal ardıcıllığını müəyyən edir. Bu ardıcıllıqlar BLASTP prosesinin növbəti mərhələsi üçün ayrılıb, burada bu qısa uyğunluqlar ilkin uyğunluqdan hər iki istiqamətdə daha uzadılmış uyğunlaşmalar üçün toxum rolunu oynayır. BLAST, matçları uzatdıqca işləyən xam hesabını saxlayır. Hər yeni amin turşusu xam xalını ya artırır, ya da azaldır. Uyğunsuzluqlara və iki düzülmə arasındakı boşluqlara görə cərimələr təyin edilir. NCBI defolt parametrlərində boşluğun olması hər bir itkin amin turşusu üçün 1 artıran 11 ilkin cəza gətirir. Hesab müəyyən edilmiş səviyyədən aşağı düşdükdən sonra uyğunlaşma dayandırılır. Xam xallar daha sonra axtarışda istifadə edilən qiymətləndirmə matrisini və verilənlər bazası axtarış sahəsinin ölçüsünü düzəltmək yolu ilə bit ballarına çevrilir.

BLASTP prosesinə ümumi baxış.
EAGLES sorğu ardıcıllığı üç hərfli sözlərə və ya sinonimlərə bölünür ki, bunlara qarşı axtarış qrupu kimi istifadə olunur.
zülal və ya tərcümə edilmiş nukleotid verilənlər bazasında qeydlər. Əlavə məlumat üçün mətnə ​​baxın.

BLASTP-dən çıxış məlumatlarına hər düzülmə üçün bit balları olan cədvəl daxildir
eləcə də onun E-dəyəri və ya &ldquoexpect ball&rdquo. E-dəyər uyğunlaşmaların sayını göstərir
Axtarış məkanında təsadüfən baş verməsi gözlənilən xüsusi bit hesabı. Ən yüksək bit balları (və ən aşağı E-dəyərləri) ilə uyğunlaşdırmalar cədvəlin yuxarısında verilmişdir. Mükəmməl və ya demək olar ki, mükəmməl uyğunluqlar üçün E-dəyər sıfır olaraq bildirilir - uyğunluğun təsadüfi baş verməsi ehtimalı əslində yoxdur. E-dəyər həm uyğunluğun uzunluğunu, həm də sorğu edilən verilənlər bazasının ölçüsünü nəzərə alır. Düzəliş nə qədər uzun olarsa və/yaxud verilənlər bazası axtarış sahəsi nə qədər böyük olarsa, müəyyən uyğunlaşmanın təsadüfən baş vermə ehtimalı bir o qədər az olar.

Bəzi hallarda, hizalanma zülalın bütün uzunluğu boyunca uzanmaya bilər və ya ardıcıllığın uyğunlaşdırılmış bölgələri arasında boşluqlar ola bilər. &ldquoMax xal&rdquo ən yüksək xalla uyğunlaşdırılmış bölgə üçün bit xalıdır. &ldquoTotal xal&rdquo bütün uyğunlaşdırılmış bölgələr üçün bit xallarını əlavə edir. Düzəlişdə heç bir boşluq olmadıqda, ümumi və maksimum ballar eyni olur. &ldquoQuery örtüyü&rdquo uyğunlaşdırma xalının həddən artıq olduğu sorğu ardıcıllığının hissəsinə aiddir. BLASTP həmçinin iki ardıcıllıqla eyni olan düzülmüş amin turşularının faizini &ldquoIdent&rdquo bildirir.


Müəllif məlumatı

Əlaqələr

Dəniz Tibbi Araşdırma Mərkəzi-Frederick, 8400 Research Plaza, Frederik, MD, ABŞ

Jesus Enrique Herrera-Qaleano, Kenneth G Frey, Regina Z Cer, Alfred J Mateczun, Kimberly A Bishop-Lilly və Vishwesh P Mokashi

Henry M. Jackson Foundation for the Advancement of Military Medicine, 6720-A Rockledge Drive, Suite 100, Bethesda, MD, 20817, ABŞ

Jesus Enrique Herrera-Qaleano, Kenneth G Frey, Regina Z Cer və Kimberly A Bishop-Lilly


Videoya baxın: Mövzu: Ardıcıllıq 1. Ardıcıllıq, 2. Qanunauyğunluğu pozan ədədin tapılması, 3. Analoji ardıcıllıq (Dekabr 2022).