Məlumat

Gen lokusunu nə ayırır?

Gen lokusunu nə ayırır?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

İntronlar, gen lokusunda ekzonları ayıran kodlaşdırılmayan DNT bölmələridir. Bununla birlikdə, fərqli gen lokusları arasında, DNT -nin kodlaşdırılmayan bölgələrinin də olduğunu düşünürəm. Bu bölgələr nə adlanır? (Və fərziyyəm səhvdirsə, lütfən məni düzəldin.)


Bu bölgələr, əgər qeyd edilməmişsə, sadəcə olaraq adlandırılır genlərarası bölgələr.

Bəzən, xromatinin böyük bir hissəsi gücləndirici/susturucu/lokus nəzarət elementi ilə tənzimlənirsə, bu xromatin bölgəsini ayıran və xromatin vəziyyətinin qonşu bölgələrə yayılmasının qarşısını alan sərhəd elementləri mövcuddur.


Onlara "nəsillərarası bölgələr" demək düzgün olardı, ancaq bu, genlər arasındakı bölgələr olduğunu söyləməyin başqa bir yoludur. Təbiətdə homojen olmadıqları üçün daha çox şey edə biləcəyinizi düşünmürəm. Bəziləri qısa ola bilər və bəlkə də @WYSIWYG tərəfindən təsvir ediləndən başqa funksiyadan məhrum ola bilər, digərləri çox uzun ola bilər və proksimal və ya distal genlər, sadə təkrarlanan ardıcıllıqlar, psevdogenlər, replikasiya mənşəli və s. üçün gücləndiricilər və tənzimləyici elementlərə malik ola bilər.


Locidən Biyologiyaya: Koroner Xəstəliklər üçün Genom Geniş Dərnəyinin Funksional Genomikası

Genom miqyaslı assosiasiya tədqiqatları aterosklerozla əlaqəli əvvəllər şübhə altına alınmayan yeni biologiyanın mövcudluğunu göstərən ≈ 58 koronar arteriya xəstəliyi (CAD) lokusunun zəngin kolleksiyasını təmin etmişdir. Bununla belə, bu tədqiqatlar yalnız CAD ilə əlaqəli genomik lokusları müəyyənləşdirir və bir çox sual, səbəbli variant(lar)ın və səbəb gen(lər)in təbiəti, eləcə də təsirin istiqaməti də daxil olmaqla, genomik lokusu qəti surətdə əks etdirdikdən sonra da qalır. . Bu lokusların funksional genomikasının tədqiqi üçün istifadə edilə bilən bir neçə alət var və məhdud sayda yeni CAD lokuslarında irəliləyiş əldə edilmişdir. Ateroskleroz və ÜAH ilə bağlı yeni biologiya bu lokusların funksional genomikası vasitəsilə öyrəniləcək və ümid odur ki, YAH patogenezinə aid olan bu yeni yollardan ən azı bəziləri YAH-ın qarşısının alınması və müalicəsi üçün yeni terapevtik hədəflər verəcəkdir.

Açar sözlər: ateroskleroz koronar arter xəstəliyi genom genomik funksional.

© 2016 American Heart Association, Inc.

Rəqəmlər

Şəkil 1. Qeyri-kodlaşdırma riski olan mexanizm…

Şəkil 1. Kodlaşdırmayan risk SNP-nin fenotipə təsir edə biləcəyi mexanizm

Yuxarı: əlaqəli çoxsaylı SNP…

Şəkil 2. GWAS funksionallığı üçün eksperimental vasitələr…

Şəkil 2. GWAS funksional təqib işləri üçün eksperimental vasitələr

GWAS tapıntıları funksional olaraq əlavə edilə bilər ...

Şəkil 3. CHD GWAS risk genləri…

Şəkil 3. CHD GWAS risk genləri aterosklerozda iştirak edən selektiv hüceyrə növlərində aktivdir


Fəsil 13 Biologiyanın mənimsənilməsi

Bir homolog xromosom atadan, digəri anadan gəlir. Qardaş xromatidlər bir-birinin eyni nüsxələridir.

Meyozun sonunda iki haploid hüceyrə var.

Meyoz II -nin sonunda adətən 4 haploid hüceyrə olur.

Telofaza I və sitokinezin sonunda, hər biri iki qardaş xromatiddən ibarət xromosomlu iki haploid hüceyrə var.

Sinapsis, homolog xromosomların cütləşməsi, I profilaktikası zamanı meydana gəlir.

Anafaza I zamanı bacı xromatidlər sentromerlərində bağlı qalırlar və homoloji xromosomlar əks qütblərə keçirlər.

Metafaza II, hüceyrənin haploid olması istisna olmaqla, mitotik metafaza ilə eynidir.

Telofazanın II və sitokinezin sonunda dörd haploid hüceyrə var.

Hüceyrələrin haploid olması istisna olmaqla, II faza əsasən mitotik profilaziya ilə eynidir.

Mitozda genetik materialını iki dəfə artırmış hüceyrə bölünərək iki diploid qız hüceyrəsi əmələ gətirir. Meyozda, genetik materialını ikiqat artıran bir hüceyrə iki dövrədən keçir və dörd haploid hüceyrə əmələ gətirir.

Meyozun yalnız I profilaktikası zamanı meydana gələn homoloji xromosomların cütləşməsinə sinaps deyilir.


Birləşdirilmiş CRISPR ekranlarından və tək hüceyrəli RNT ardıcıllığından istifadə edərək hədəf genlərin və qan əlamətlərinin yerlərinin yollarının kəşfi

Genom-geniş assosiasiya tədqiqatları (GWAS) ilə müəyyən edilmiş kompleks əlamətlər və ümumi xəstəliklərlə əlaqəli variantların əksəriyyəti genomun kodlaşdırılmayan bölgələrinə naməlum tənzimləyici təsirlərə malikdir. cistrans. Biobank miqyaslı GWAS məlumatlarından, kütləvi şəkildə paralel CRISPR ekranlarından və tək hüceyrəli transkriptomun ardıcıllığından istifadə edərək, qan əlamətlərinin lokalizasiyası üçün kodlaşdırılmayan variantların hədəf genlərini kəşf etdik. Ən yaxın gen çox vaxt hədəf gen idi, lakin bu həmişə belə olmurdu. Biz də müəyyən etdik trans-kodlaşdırılmayan variantlar şəbəkələrini nə vaxt təsir edir cis kimi hədəf genləri kodlayan transkripsiya faktorları GFI1BNFE2. GFI1B olduğunu müşahidə etdik trans-hədəf genlər GFI1B bağlama yerləri və incə xəritələnmiş GWAS variantları üçün zənginləşdirilmiş və insan sümük iliyinin progenitor hüceyrələrində ifadə edilmişdir ki, bu da GFI1B-nin qan əlamətlərinin əsas tənzimləyicisi kimi çıxış etdiyini göstərir. Bu platforma, hər ikisində insan kodlaşdırmayan variantlarının hədəf genlərini kataloqlaşdırmaq üçün kütləvi paralel analizlərə imkan verəcəkdir. cistrans.


Mürəkkəb əlamətlərin genetikası üçün hesablama metodları

Robert Culverhouse, Genetikada irəliləyişlər, 2010

1 İki nümunə

Birincisi, bir genetik analizdəki qarşılıqlı təsir effektinin böyüklüyünün genetik modelin xas bir xüsusiyyəti olmadığını, ancaq məlumatların allel tezliklərindən asılı olduğunu göstərən nəzəri bir nümunədir. Templeton (2000) ümumi serum xolesterolu (TSC) üçün iki lokuslu genetik model qurmuşdur. ApoELDLR (Pedersen və Berg, 1989 Pedersen və Berg, 1990). Bu modelin Avropa allel tezliklərinə əsaslanaraq təhlili (ApoE ε2, ε3 və ε4 üçün müvafiq olaraq 0,078, 0,77 və 0,152 tezlikləri və LDLR üçün 0.22 və 0.78 tezlikləri A1A2sırasıyla), bunu təklif edərdi ApoE genetik variasiyanın 77,7%-ni (52,8 mg 2 /dl 2) təşkil edən TSC üçün “əsas gen”dir. LDLR kiçik oyunçudur, genetik variasiyanın yalnız 5,5%-ni təşkil edir. Qalan 16,8% genetik variasiya qarşılıqlı təsirə aid edilə bilər və yalnız variantlar birgə təhlil edildikdə aşkar edilə bilər.

Templeton daha sonra fərqli allel tezlikləri olan hipotetik bir populyasiyada eyni genetik modeli qiymətləndirdi (ApoE ε2, ε3 və ε4 üçün müvafiq olaraq 0,02, 0,03 və 0,95 tezlikləri və LDLR hər ikisi üçün 0,5 tezliyi A1A2). Bu hipotetik əhalinin təhlili bunu göstərdi ApoE Bu xüsusiyyətə (genetik varyansın 11.9% -ni təşkil edir) yalnız kiçik bir köməkçi idi LDLR “əsas gen” lokusu idi (diferensiyanın 81,4%-ni təşkil edir) və qarşılıqlı təsirin çox da güclü olmadığı (diferensiyanın yalnız 6,4%-ni təşkil edir).

Bu nəticələr göstərir ki, mürəkkəb xəstəlikləri öyrənərkən, qarşılıqlı təsir müddətinin ölçüsü kimi xüsusi parametrləri qiymətləndirməkdənsə, əlamət dəyişikliyinə töhfə verənlərin müəyyən edilməsinə diqqət yetirmək daha vacib ola bilər.

Qarşılıqlı əlaqə parametrinin əhəmiyyətinə çox diqqət yetirərək vacib bir şeyi necə əldən verə biləcəyinə dair ikinci bir nümunə, siqaret çəkməklə bağlı məlumatların son araşdırmasında tapıldı. Standart tək dəyişkənlik təhlili, nikotin asılılığı ilə eyni olmayan kodlaşdırma SNP, rs16969968, arasındakı əlaqəni müəyyən etdi. CHRNA5, nikotinik reseptor alt vahid geni. RPM də bu SNP -ni çox əhəmiyyətli hesab etdi (fenotipik dəyişkənliyin 1.22% -ni təşkil edir). Bununla birlikdə, nikotinik reseptor SNP -lərinin cüt analizində RPM, yaxınlıqdakı ikinci bir rs3743075 variantını təyin etdi, bu da özlüyündə əhəmiyyətli deyildi (ya RPM və ya standart birdəfəlik analizlə), lakin rs16969968 ilə birləşdirildikdə 1.83 təşkil edir varyansın %. Bununla belə, bu cüt proqnozlaşdırıcılardan istifadə edən logistik reqressiya rs3743075-in tək başına əhəmiyyətli olmadığını göstərdi (səh = 0,36), nə də qarşılıqlı təsir (səh = 0.27).

Bununla belə, qarşılıqlı əlaqə termini olmasa belə, hər iki SNP-ni əhatə edən logistik model, iki birdəyişən effektin cəmindən 25% daha çox xüsusiyyət dəyişkənliyini təşkil edir. Əslində, hər bir SNP birgə təhlildə birdəyişənli analizdə olduğundan daha əhəmiyyətli oldu.

Bu təəccüblü nəticənin səbəbi, rs16969968 və rs3743075 üçün risk allellərinin mənfi əlaqəli olmasıdır. Rs16969968 rs3743075 -dən daha böyük bir təsirə malik olduğundan, rs3743075 tək başına təhlil edildikdə, təsiri demək olar ki, rs16969968 ilə maskalanır. Rs16969968 tək analiz edildikdə, təsiri rs3743075 ilə bir qədər azalır, amma yenə də özünü göstərir.

Bu halda, ya əhəmiyyətli bir əsas effekt, ya da əhəmiyyətli qarşılıqlı təsir tələb etmək, rs3743075-in nikotin asılılığına verdiyi töhfənin müəyyən edilməməsi ilə nəticələnəcəkdi. Göründüyü kimi, rs3743075 birdəyişənli analizlərdə nikotin asılılığı ilə əlaqəli olmasa da, ifadəsi ilə əlaqələndirilir. CHRNA5, rs16969968 zülalını dəyişdirən gen.


Gen lokusunu nə ayırır? - Biologiya

"İfadə kəmiyyət xüsusiyyəti Loci Hüceyrə fərqliliyinə yüksək həssasdır ". PLOS Genetics 5 (10): e1000692. Doi: 10.1371/journal.pgen.1000692. PMC 2757904. PMID 19834560.
^ Michaelson JJ, Loguercio S, Beyer A (İyul 2009).

Üç üçün allellərin fərqli olduğuna diqqət yetirin lokus üst -üstə düşməyin. Aşağı paneldə D3S1358, vWA və FGA üçün Bob Blackettin anası Norma üçün allellər göstərilir. lokus. Normanın allelləri kompüter tərəfindən istinad standartları ilə müqayisə edilmiş və etiketlənmişdir.

Loci: Bax Locus.
Lokus (pl. lokus): Bir genin və ya başqa bir xromosom markerinin bir xromosomundakı mövqeyi, bu mövqedəki DNT. Lokusun istifadəsi bəzən ifadə edilən DNT -nin orta bölgələri ilə məhdudlaşır. Bir genin xromosomdakı xüsusi fiziki yeri. Latın dilindən "yer" deməkdir.

)
Müəyyən bir genetik xüsusiyyətin yerləşdiyi bir xromosomdakı mövqe. Bəzən eyni funksiyanı təsir edən çoxlu genləri təsvir etmək üçün istifadə olunur.
LPS
Lipopolisakkarid. Qram-mənfi bakteriyaların xarici membranının xarici təbəqəsinin əsas komponenti.

(loh-kus) [L., yer]
Müəyyən bir genin yerləşdiyi müəyyən bir xromosom boyunca müəyyən bir yer.

populyasiyaların xəritələşdirilməsində məhsul, məhsul komponentləri, başlıq tarixi, bitki boyu və quraqlıqda fizioloji və inkişaf xüsusiyyətləri də müəyyən edilmişdir (Maccaferri et al., 2008DZ Habash et al., nəşr olunmamış məlumatlar).
Aqronomik əlamətlər üçün QTL analiz tədqiqatları.

eyni xromosomda
Mənbə: Jenkins, John B. 1990. Human Genetics, 2nd Edition. New York: Harper və Row
.

AT-lə zəngin lider ardıcıllığından ibarətdir və bunun ardınca spacer bölgələri ilə ayrılmış çoxlu, qısa nukleotid təkrarlanır. Təkrarların bir çoxu palindromikdir, proqnozlaşdırılan RNT hairpin ikincil quruluşuna malikdir, digərlərində simmetriya yoxdur və strukturlaşdırılmamış RNT əmələ gətirir.

birləşmiş effekt yaratsa buna poligeniya deyilir.)
Misal:
Hündürlüyün yalnız iki gen tərəfindən idarə olunduğunu düşünün (əslində bir çox gen yüksəkliyə kömək edəcək). Hər birinin iki aleli var E və e, F və f.

(ümumi) Bir yer, məkan və ya məkan, xüsusən də bir fəaliyyət mərkəzi.
(riyaziyyat) Koordinatları müəyyən bir tənliyi və ya şərti təmin edən bütün nöqtələr toplusu.

)
müəyyən bir genin yerləşdiyi müəyyən bir xromosom boyunca müəyyən bir yer.
BIOL1020 Lab 7 Genetika ilə əhatə olunmuşdur
lizosom
eukaryotik hüceyrələrin sitoplazmasında tapılan hidrolitik fermentlərdən ibarət membranla bağlanmış çanta.

7) Genlər a adlı xromosomun müəyyən yerlərində yerləşir

. Allel adlanan bir populyasiyada mövcud olan bir genin fərqli versiyaları ola bilər.

) analiz edilən bütün siçan suşları üçün genotip edilmişdir.
Xromosom
SNP sayı.

mitoxondrial DNT-də yerləşir
3. Korrelyasiya genotip-fenotip.

bir növdə (məsələn, siçan) başqa bir növdə (məsələn, insanlar) əlaqəli olan homoloqlar var.
MGI Sözlüyündə Synteny -ə baxın.

Dördüncü dövr quruluşu
(Tarix: 28.03.2011). ilk insan randomizə nəzarətli sınağını tamamladılar. böyrəyə daxil edilən kateter əsaslı zonddan istifadə edir. böyrək yaxınlığındakı sinirlər (və ya böyrəkdə. Tədqiqatçılar bu nəticələrin RDN olduğunu təsdiq etdiyini söyləyirlər.

Məsafələr, iki genin tezliyini təyin edən əlaqə analizi ilə qurulur

xromosom rekombinasiyası zamanı ayrılırlar. (Xəritəyə baxın.) Genetik marker. Mikrobların hərəkətini "işarələmək" və ya izləmək üçün istifadə edilən gen və ya genlər qrupu. Genom.

Homoziqot -- bir və ya bir neçədə eyni allellərə malik olan

homoloji xromosom seqmentlərində. Təmizlik genləri -- bütün hüceyrələrdə ifadə olunan genlərdir, çünki onlar bütün hüceyrə növlərinin saxlanması üçün lazım olan funksiyaları təmin edirlər. HUGO -- İnsan Genom Təşkilatı.

Allellərin birləşmiş təsiri fərqli olduqda

onların fərdi təsirlərinin cəminə bərabərdir. (ORNL)
Adenin (A)
Azotlu bir baz, AT cütlüyünün bir üzvü (adenin-timin).
Həmçinin baxın: əsas cüt (ORNL)
Alqoritm
Kompüter proqramında təcəssüm olunmuş sabit prosedur. (NCBI)
Hizalama.

Orta heterozigotluq, genin dəyişkənliyini, genin orta faizini ölçür

homozigotdur (sabitdir).
Təxminən 14% (1800 gen) heterozigotdur.

Mayada, Sir2 üçdə genomik susdurma üçün lazımdır

, telomerlər və ribozomal DNT (rDNA).

bir-birinə daha yaxın olanlar xromosomal krossover zamanı fərqli xromatidlərə ayrılma ehtimalı azdır və buna görə də genetik olaraq bağlı olduqları deyilir. (wikipedia.org) 3. Bu termin, müəyyən genlərin eyni xromosomda olduğu üçün birlikdə miras qalma meylini ifadə edir.

Bu fenomenin bir hadisəsi burada baş verir

əsas insan uyğunluq kompleksində (MHC), burada bəzi insan allelləri digər şimpanze allelləri ilə digər insan allellərinə nisbətən daha yaxından əlaqəlidir (Şəkil 7).

Genlərin fərqli olaraq miras qaldığı vəziyyət

qırmızı hüceyrə fenotiplərini yaratmaq üçün qarşılıqlı əlaqə qurur, məsələn, Le le genləri müxtəlif Lewis qırmızı hüceyrə fenotiplərini yaratmaq üçün Hh və Se se genləri ilə qarşılıqlı əlaqə qurur.

Boy olaraq nümunə götürsək, bunun dörd fərqli əlavə genləri tərəfindən idarə olunduğunu söyləyə bilərik

. Səkkiz allelin hamısını "uzunluq" üçün alsanız, bir həddindən artıq yüksəklikdə olursunuz, "qısa" üçün səkkiz allel alsanız, yüksəklik spektrinin digər ucunda olacaqsınız.

X ilə əlaqəli metilasyon nümunələri Bir neçə

X xromosomunda mövcud olanlar aktiv olmadıqda yüksək metilatlanır, lakin aktiv X xromosomunda metilsiz qalır (Lyon hipotezi).

.
HE (gözlənilən heterozigotluq) gen müxtəlifliyi kimi də tanınır (= D-ə üstünlük verilir, daha az qeyri-müəyyən termin) və 1 kimi hesablanır.

Məsələn, MHC Class II gendir

. Bu səbəbdən iki şəxsin nə qədər yaxın qohum olduğunu anlamaq üçün faydalı bir yoldur.

Aralarındakı məsafə nə qədər böyükdürsə

Bir xromosomda iki gen varsa, bu genlər arasındakı rekombinasiya tezliyi daha yüksəkdir. Bu doğrudur, çünki allellər xromosomun daxilində bir -birinə daha yaxın olduqda, xromosom ucları keçərək mübadilə edildikdə onların bir yerdə qalması ehtimalı daha yüksəkdir.

. Xəritədə 1 centiMogan (cM) məsafəsi 1%rekombinasiya nisbətinə bərabərdir. Kiçik məsafə üçün rekombinasiya tezliyi (RF) xəritə məsafəsinə mütənasibdir.

linkage / LINK-əj / Fərqli iki allelin artma meyli

müəyyən bir xromosomda bir -birinə daha yaxındır (yəni.

özləri.
Axtarış səhifəsinə qayıt
Əlavə etməyiniz lazım olduğunu düşündüyünüz bu lüğətdən silinmiş hər hansı bir termin bilirsinizsə, təfərrüatları GenScript -də Redaksiyaya göndərin.

Nəticədə, spesifik allellər iki fərqli olur

təsadüfən gözləniləndən daha çox və ya daha az birlikdə tapılır. Eyni vəziyyət iki alleldən çox ola bilər. Onun böyüklüyü delta (D) dəyəri kimi ifadə edilir və gözlənilən və müşahidə edilən haplotip tezliyi arasındakı fərqə uyğundur.

müəyyən bir fenotipin əlaqəsinin kəmiyyət və statistik olaraq təyin olunduğu.
Randombred. Siçan ehtiyatları sistematik təsadüfi sxemlə saxlanılır. Təsadüfi cinsli siçanlar genetik olaraq heterojendir, lakin genetik cəhətdən siçanlara nisbətən sabitdir.

Genetikada iki fərqli meyl var

olanlar, onların əlaqəsi nə qədər böyükdür və aralarındakı rekombinasiya tezliyi bir o qədər az olar.
Tam lüğət.

Əlbəttə ki, yuxarıda göstərilən nümunə uyğunlaşma landşaftında iki fitness zirvəsi olan bir lokus əsasında sadələşdirilmiş nümunədir. Real dünyada çox, çox

Gen ailəsi: Müxtəlif növləri əhatə edən əlaqəli genlər toplusu

DNT -də, demək olar ki, ata -baba bir genin çoxalması nəticəsində yaranır və oxşar bir ardıcıllığa malikdir. Bir gen ailənin üzvləri funksional olaraq çox oxşar və ya çox fərqli ola bilər. Globin gen ailəsi buna nümunədir. (PBS təkamül lüğəti).

İki bağlı heterozigotun allel düzülüşü

, burada hər bir homoloji xromosomda bir mutant (a və ya b) və bir vəhşi tip (A və ya B) allel (yəni Ab/aB) vardır. Aranjımanda iki əlaqəli heterozigot gen cütü, Ab/aB.

genlər arasında funksional yenidən qurulmanın baş verdiyi immunoqlobulin və ya T hüceyrə reseptoru (TCR) genləri kimi. Allellərdən biri ya funksional olmayan, ya da natamam şəkildə yenidən təşkil edilmiş və ifadə edilməmişdir. Beləliklə, hər T-hüceyrə yalnız bir TCR gen dəstini ifadə edir.

Dihibrid çarpaz, iki fərqli heterozigot olan fərdlər arasındakı çarpazdır

.
Mendelin ikinci qanunu müstəqil çeşid qanunu olaraq da bilinir. Müstəqil çeşid qanunu, bir genin allellərinin başqa bir genin allellərindən asılı olmayaraq gametlərə ayrıldığını bildirir.

(genlər və ya digər genetik markerlər) bir xromosom boyunca.
genetik rekombinasiya
İki valideynin xüsusiyyətlərini birləşdirən nəsil istehsalı üçün ümumi termin.

və meyoz zamanı cütləşə bilənlərdir.
Homozigot, müəyyən bir genin allelinin eyni olduğu bir vəziyyətdir.
Humus, çürümüş bitki və heyvan qalıqlarından əldə edilən qara saqqıza bənzər bir maddədir.

kəmiyyət əlaməti Çoxlu qarşılıqlı əlaqə ilə müəyyən edilən genetik əlamət

, və bunun üçün fenotipik ekstremallar arasında bir sıra fenotiplər var.
kvark Atomun nüvəsində yerləşən subatomik hissəcik.

- Bəzi genlərin yaxınlığına görə fərdi deyil, qrup şəklində miras alınma meylinin ölçüsü

xromosomda
Likopen
- fitokimyəvi sərbəst radikalları zərərsizləşdirdiyi sübut edilmiş güclü bir antioksidandır. Likopen karotenoidlər ailəsinə aiddir.

İnsan beta-globin genləri beşdə dağılır

insan xromosomunda 11. Bu genlər inkişaf zamanı ardıcıl olaraq ifadə edilir və hər bir gendə oxşar mövqelərdə olan eyni uzunluqlu intronlar ilə oxşardır. Genlərin bəziləri inaktiv nüsxələrdir, digərləri yalnız müəyyən inkişaf mərhələlərində funksionaldır.

Dəyişdirici genlər: Başqa bir genin ifadə səviyyəsinə təsir edən genlər. Üzərində yerin olmaması

özlərini başqa genlərə bağlayırlar.
Fenotip: Bir insanın xarici görünüşü
Genotip: Bir insanın genetik quruluşu.

Genetikanı müəyyən etməyə çalışan beynəlxalq bir konsorsium

insan bədəninin ölçüsünü və formasını tənzimləyən:
GIANT konsorsiumu
İdman Tibb və Elm Ensiklopediyası:
Yağ toxuması.

Kəmiyyət genetikasının daha yeni inkişafı kəmiyyət xüsusiyyətinin təhlilidir

ardıcıl lokus Ardıcıl

proqnozlaşdırılan və eksperimental olaraq təsdiqlənmiş transkripsiya edilmiş bölgələri əhatə edir.

nüvəcik. Hüceyrə nüvəsi daxilində mikroskopik olaraq görünən bölgə və ya "kompartament". Zülal və DNT konsentrasiyasını ehtiva edir

müvafiq DNT sekanslarının ribosomal RNT (rRNA) halına salınması üçün lazımdır. Digər nüvə bölmələri və ya 'cisimlər' kimi, nüvəcik membrana bağlanmır.

Bir lokus, bir genin və ya bir xromosomdakı digər DNT ardıcıllığının, genetik bir küçə ünvanı kimi, xüsusi fiziki yeridir. Lokus cəmidir "


Genetik və Fiziki Xəritəçəkmə Arasındakı oxşarlıqlar

  • Genetik və fiziki xəritələşdirmə, müxtəlif növ genom xəritələri istehsal edən iki növ genom xəritəçəkmə texnikasıdır.
  • Genomda müvafiq mövqeləri olan molekulyar markerlər toplusundan istifadə edirlər.
  • Hər ikisi də müəyyən bir fenotipə və ya müəyyən bir variantdan məsul olan mutasiyaya səbəb olan genlərin tanınmasına imkan verir.
  • Ayrıca, genom xəritələşdirilməsi bir çox aşağı axın prosesinin ilkin prosesidir.
  • Nümunə olaraq, xəstəliklərlə əlaqəli genetik elementləri müəyyən etməyə kömək edir.

Gen Xəritəçəkmə Prinsipləri & Təcrübə Problemləri

Genetik xəritə, sadəcə, bir sıra lokusların genom içərisində paylanmasının bir nümayəndəsidir. Müstəntiq tərəfindən hər hansı bir xəritəçəkmə layihəsinə daxil edilən yerlərin bir-biri ilə heç bir əlaqəsi ola bilməz və ya funksional və ya struktur homologiyalar və ya əvvəlcədən müəyyən edilmiş xromosom təyinatı daxil olmaqla, bir sıra parametrlərdən hər hansı birinə görə əlaqəli ola bilər. Bu lokusların xəritələşdirilməsi bir çox fərqli qətnamə səviyyələrində həyata keçirilə bilər. Ən aşağı səviyyədə, lokus başqa bir lokalizasiya olmadan sadəcə müəyyən bir xromosoma təyin edilir. Yuxarıdakı bir addımda, müəyyən bir xromosomal bölgəyə bir tapşırıq verilə bilər. Daha yüksək qətnamə səviyyəsində, əlaqəli dəstdə fərdi lokusları ayıran nisbi sıra və təxmini məsafələr müəyyən edilə bilər. Daim artan qətnamə səviyyələri ilə nizam və interlokasiya məsafələri daha çox və daha dəqiqliklə müəyyən edilə bilər. Nəhayət, lokuslar DNT ardıcıllığının özünə uyğunlaşdırıldıqda son qətnamə əldə edilir.

Ən sadə genetik xəritələr bir-biri ilə əlaqəli iki lokus haqqında məlumat ehtiva edə bilər. Əks tərəfdən, bütün xromosom boyunca mövcud olan minlərlə genin hamısının dəqiq fiziki yerini təsvir edən tam fiziki xəritələr olacaq. Bu tam fiziki xəritələrin yaranması yolunda ilk addım son zamanlarda iki tam insan xromosom qolu boyunca üst -üstə düşən klonların tək kontiglarının qurulması ilə əldə edilmişdir.

Əslində, genomdakı hər bir xromosom üçün (Y-dən başqa) əldə edilə bilən bir deyil, üç fərqli genetik xəritə növü var. Xəritələrin üç növü - əlaqə, xromosom və fiziki - həm onların alınması üçün istifadə olunan üsullara, həm də onların daxilində məsafələri ölçmək üçün istifadə olunan metrikaya görə fərqlənir.

Əlaqə xəritələri
Rekombinasiya xəritəsi olaraq da adlandırılan əlaqə xəritəsi, 20-ci əsrin əvvəllərində Mendelin işinin yenidən kəşfindən dərhal sonra hazırlanmış ilk xəritə idi. Bağlantı xəritələri yalnız iki və ya daha çox irsi formada və ya alleldə baş verən yerlər üçün qurula bilər. Beləliklə, monomorfik lokuslar - yalnız bir alleli olanlar bu şəkildə xəritələndirilə bilməz. Bağlantı xəritələri iki və ya daha çox lokusda iki fərqli allel daşıyan bir valideyndən ya valideyn, ya da rekombinant allel birləşmələri alan övladların sayını hesablamaqla yaradılır. Bu tip məlumatların təhlili lokusların bir-biri ilə “bağlı olub-olmadığını” və əgər varsa, onların nisbi sırasını və onları ayıran nisbi məsafələri müəyyən etməyə imkan verir.

Bağlantı xəritəsi

Xromosom təyinatı hər dəfə yeni lokusun əvvəllər təyin edilmiş lokusla əlaqədə olduğu aşkar edildikdə yerinə yetirilir. Məsafələr santimorqanlarla ölçülür, bir santimorqan 1% krossover nisbətinə bərabərdir. Bağlantı xəritəsi klassik heyvandarlıq təhlilinə əsaslanan yeganə növdür. 'Genetik xəritə' termini bəzən 'əlaqə xəritəsi' üçün yanlış sinonim kimi istifadə olunur, genetik xəritə əslində həm xromosom, həm də fiziki xəritələri əhatə etmək üçün daha geniş şəkildə müəyyən edilir.

Xromosom xəritələri
Xromosom xəritəsi (və ya sitogenetik xəritə) siçan genomunun karyotipinə əsaslanır. Bütün siçan xromosomları ölçülərinə və bantlama modelinə görə sitogenetik səviyyədə təyin olunur və nəticədə bütün xromosom təyinatları birbaşa sitogenetik analizlə və ya əvvəllər bu şəkildə xəritələnmiş bir lokusa bağlanmaqla aparılır. Xromosom xəritələrinin mövqeləri bant adlarının istifadəsi ilə göstərilir. Bu adlandırma sxemində xromosom boyunca lokuslar sifariş etmək üçün bir vasitə var.

Xromosom xəritəsi

Bu gün xromosom xəritələrini yaratmaq üçün müxtəlif səviyyəli qətnamə ilə bir neçə fərqli yanaşma istifadə edilə bilər. Birincisi, bəzi hallarda dolayı xəritəçəkmə başqa bir növün genomu mühitində siçan karyotipinin yalnız hissələrini ehtiva edən bir və ya bir neçə somatik hüceyrə hibrid xəttinin istifadəsi ilə həyata keçirilə bilər. Müəyyən bir siçan geninin varlığını və ya ifadəsini bu hüceyrələrdə bir siçan xromosomunun və ya subxromosomal bölgənin olması ilə əlaqələndirməklə, bir xromosom və ya subxromosomal təyinat əldə etmək olar.

İkinci yanaşma, karyotipik anomaliyaların müəyyən mutant fenotipləri ilə birlikdə göründüyü xüsusi hallarda istifadə edilə bilər. Xromosom lezyonu və fenotip bir arada, bir nəsildən digərinə keçdikdə, ehtimal ki, birincisi ikinciyə səbəb olur. Lezyon silinmə, translokasiya, inversiya və ya təkrarlanma olduqda, pozulmuş xromosom zolağına mutant lokus təyin edilə bilər.

Nəhayət, lokus-spesifik DNT zondunun mövcudluğu ilə müəyyən bir xromosom zolağı daxilində müvafiq ardıcıllığın yerini birbaşa vizuallaşdırmaq üçün in situ hibridləşdirmə metodundan istifadə etmək mümkün olur. Bu yanaşma hər hansı bir əlaqədən və ya fərziyyələrdən asılı deyildir və bu səbəbdən mövcud olan ən birbaşa xəritələşdirmə yanaşmasıdır. Bununla belə, texniki cəhətdən tələbkardır və onun həlli əlaqə və ya fiziki yanaşmalarla əldə edilən qədər yüksək deyil.

Fiziki xəritələr
Üçüncü növ xəritələr fiziki xəritələrdir. Bütün fiziki xəritələr birbaşa DNT analizinə əsaslanır. Lokuslar arasındakı və içərisindəki fiziki məsafələr baza cütlərdə (bp), kilobasepairs (kb) və ya megabasepairs (mb) ilə ölçülür. Fiziki xəritələr özbaşına olaraq qısa və uzun məsafəyə bölünür. Qısamüddətli xəritələşdirmə ümumiyyətlə 30 kb -ə qədər olan məsafələrdə aparılır. Çox təxmini ifadələrlə desək, bu, genin orta ölçüsüdür və eyni zamanda kosmid əsaslı genomik kitabxanalardan əldə edilən klonlanmış əlavələrin orta ölçüsüdür. Bu ölçülü klonlaşdırılmış bölgələr, məhdudlaşdırma fermentləri ilə asanlıqla yüksək qətnamə ilə xəritələnə bilər və sıralama texnologiyasındakı inkişaflarla birlikdə, bu uzunluqdakı maraqlı bölgələri bütünlüklə ardıcıllıqla sıralamaq daha çox yaygınlaşır.

DNT fraqmentlərinin ayrılması və ölçülməsinə imkan verən ümumi olaraq impulslu sahə gel elektroforezi və ya PFGE kimi adlandırılan müxtəlif gel elektroforez üsulları ilə birlikdə nadir kəsici məhdudlaşdırıcı fermentlərin istifadəsi ilə meqabaza ölçülü bölgələrdə birbaşa uzunmüddətli fiziki xəritəçəkmə həyata keçirilə bilər. 6 mb və ya daha çox uzunluğa malikdir. PFGE xəritələşdirmə tədqiqatları birbaşa genomik DNT üzərində aparıla bilər, sonra müəyyən lokuslar üçün problarla Southern blot analizi aparılır. İki lokus üçün zondlar, eyni ləkəyə ardıcıl hibridləşmə nəticəsində eyni böyük məhdudlaşdırma fraqmentlərini aşkar etdikdə fiziki əlaqəni nümayiş etdirmək mümkün olur.

Fiziki xəritə

Uzun məsafəli xəritəçəkmə, maya süni xromosomunun (YAC) klonlama vektorlarına əsaslananlar kimi böyük insert genomik kitabxanalarından əldə edilən klonlarla da həyata keçirilə bilər, çünki bu klonlardakı bölgələr əlavə təhlil üçün asanlıqla təcrid oluna bilər. Gələcəkdə üst-üstə düşən klonlardan ibarət uzun mənzilli fiziki xəritələr siçan genomundakı hər bir xromosomu əhatə edəcək. Yüksək rezolyusiyaya malik qısa diapazonlu məhdudiyyət xəritələri hər bir xromosom uzunluğu boyunca birləşdiriləcək və nəticədə, bəlkə də, bütün xromosom DNT ardıcıllığı ilə xəritəçəkmə həllinin ən yüksək səviyyəsinə nail olunacaq.

Xəritələr arasındakı əlaqə
Nəzəri olaraq, əlaqə, xromosom və fiziki xəritələrin hamısı xromosom təyinatı və yerlərin sırası haqqında eyni məlumatı təmin etməlidir. Ancaq hər bir xəritədə ölçülən nisbi məsafələr olduqca fərqli ola bilər. Yalnız fiziki xəritə lokusları bir -birindən ayıran faktiki DNT uzunluğunun dəqiq təsvirini verə bilər. Bu o demək deyil ki, digər iki növ xəritələr qeyri-dəqiqdir. Əksinə, hər biri fiziki xəritənin fərqli parametrə görə modulyasiya edilmiş versiyasını təmsil edir. Sitogenetik məsafələr DNT molekulunun müxtəlif xromosom bölgələrinə nisbi qablaşdırılması ilə modullaşdırılır. Bağlantı məsafələri, fərqli DNT bölgələrinin rekombinasiya hadisələrində iştirak etmək üçün dəyişkən meyli ilə modulyasiya olunur.

Praktikada, siçanın genetik xəritələri tez -tez xromosom, əlaqə və fiziki xəritələrin birləşməsidir, lakin bu yazı yazılarkən klassik rekombinasiya tədqiqatları bu cür inteqrasiya olunmuş xəritələrə daxil edilmiş məlumatların böyük hissəsini təmin edir. Beləliklə, interlocus məsafələrini cədvəlləmək üçün istifadə olunan əsas metrik sentimorgan olmuşdur. Bununla belə, növbəti beş il ərzində meqabazanın xromosom boyu ölçü vahidi kimi santimorqanı keçəcəyini proqnozlaşdırmaq ağlabatan görünür.


Model

Altı demoqrafik parametrlə iki əsas əhalinin təcrid-miqrasiya modelinə diqqət yetiririk: üç populyasiya üçün üç təsirli populyasiya ölçüsü (1, 2 və əcdadlar üçün), iki miqrasiya dərəcəsi (hər istiqamət üçün bir) və ata -baba əhalinin iki nəsil populyasiyaya ayrıldığı vaxt. Ayrılma vaxtını ayırırıq, t, birləşmə prosesində hadisələrin xüsusi növlərinin dərəcələrini təmin edən parametrlərdən (yəni, miqrasiya və biz birlikdə Φ) kimi istinad etdiyimiz əhali ölçüsü parametrləri. Parametrlər lokuslar üzrə orta mutasiya dərəcəsi ilə ölçülür μ, və buna görə də effektiv ölçülər 4 ilə verilirN.iμ, miqrasiya nisbətləri mij = Mij/μvə bölünmə vaxtı t = , harada N.i effektiv ölçüsüdür ici əhali, Mij əhali arasında nəsil başına düşən miqrasiya nisbətidir ijT bölünmə vaxtıdır (nəsillərlə) (Hey and Nielsen 2004). Çoxlu lokus vəziyyətində, hər bir lokus l bir mutasiya dərəcəsi skalyarına da sahib olacaq ul və miras skalyarı hl, buna görə də lokuslar arasında mutasiya nisbətlərində və miras rejimlərində açıq şəkildə dəyişkənliyin modelləşdirilməsi (Hey və Nielsen 2004). Lokuslar arasında heç bir rekombinasiya və lokuslar arasında sərbəst rekombinasiya nəzərdə tutulmur.

Nəzəri tədqiqatlar göstərdi ki, seleksiyanın əlaqəli neytral ərazilərə təsiri seleksiyanın yaratdığı gen axınına maneə ilə mütənasib olaraq miqrasiya nisbətinin azalması ilə sırf neytral proseslə yaxşı təxmin edilir (Petry 1983 Barton və Bengtsson 1986 Charlesworth və s. 1997 Navarro və Barton 2003a Fusco və Uyenoyama 2011). Eynilə, istiqamət və ya fon seçimi altında olan genomun bölgələri ilə əlaqəli neytral lokuslar, selektiv gücə mütənasib olaraq təsirli ölçülərində azalmalara məruz qalırlar (Charlesworth və s. 1993 Galtier və s. 2000 Charlesworth 2009 Gossmann və s. 2011). Demoqrafik parametrlərin dəyişdirilməsi ilə fərqli seçim üsulları modelləşdirilə bilər. Məsələn, hibridlərdə ya yerli uyğunlaşma, ya da genetik uyğunsuzluqlar nəticəsində yaranan gen axını əleyhinə seçim, miqrasiya nisbətlərinin azalması kimi əks olunacaq. Adaptiv introqressiya, miqrasiya nisbətlərinin artmasına səbəb olardı. Eyni şəkildə, təkrarlanan selektiv süpürgələrə məruz qalan genomik bölgələr, təsirli bir ölçüdə azalma olaraq görüləcəkdir. Buna görə də biz güman edirik ki, seçimin əlaqəli saytlardakı təsirləri dəyişdirilmiş miqrasiya nisbətləri və/yaxud effektiv əhali ölçüləri baxımından təsvir edilə bilər. Lokusların qruplara təsnif edildiyi bir modeli nəzərdən keçiririk ki, hər bir qrupun öz miqrasiya nisbəti və/yaxud effektiv populyasiya ölçüsü parametrləri var və beləliklə, bütün lokusların eyni demoqrafiyanı paylaşdığı fərziyyəsini yüngülləşdiririk. Bu ümumi çərçivədə, bütün lokuslar tərəfindən paylaşılan qalan altı demoqrafik parametrdən yalnız biri t.

Prinsipcə, lokus qruplarının sayı bilinməyən hesab edilə bilər, lakin biz maksimum qrup sayının olduğu vəziyyətə diqqət yetiririk. K is set by the investigator and specifically on the simplest case where loci can be classified into two groups (K = 2) representing (1) loci with histories affected by linkage to genes under selection and (2) loci not affected by selection. It is important to appreciate that the identification of a group as having loci affected by selection depends entirely upon how the investigator interprets the parameter estimates of the different groups of loci. Here we focus on the case of selection against gene flow, and hence the group of loci with reduced migration rate estimates corresponds to loci potentially linked to sites under selection. The assignment of loci to groups is represented by an assignment vector a, harada al is the group to which locus l belongs, l = (1, … , L). For instance, in a case with four loci and two groups, a = (1, 1, 2, 2) indicates that loci 1 and 2 belong to group 1 and loci 2 and 3 belong to group 2. With more than one group of loci the set of migration and effective population size parameters, Φ, will include additional terms. In the above example, instead of one set of effective sizes (three parameters) and one pair of migration rates (two parameters), the model includes one set for each group, that is, two sets of effective sizes (six parameters) and two sets of migration rates (four parameters).

Given genetic data from L independent loci, sampled from each of two closely related populations or species, the goal is to obtain an estimate of the vector of locus assignments, , as well as the demographic parameters of the IM model, and . To connect the data to these unknowns we consider for locus l a genealogy, Gl, and for all loci the set of genealogies, G = (Gl, … , GL), that describe the historical coancestry of the sampled sequences, including the tree topologies, as well as the times of coalescent and migration events (Hey and Nielsen 2004). As conceptualized by Felsenstein (1988) and now common practice in population genetics inference (məs., Kuhner və s. 1998 Beaumont 1999 Beerli and Felsenstein 1999 Hey and Nielsen 2004 Kuhner 2006), we consider the range of possible genealogies by approximating an integration over the genealogical space. Following the approach developed by Hey and Nielsen (2007) this integration provides for the posterior probability of the parameters of interest, (1) where π(Φ|G, t, a) is the conditional probability of the parameters given the genealogies, the splitting time, and the assignment, and π(G, t, a|X) is the probability of genealogies, splitting time, and assignment given the data. Although this integral is not analytically tractable except for the very small sample sizes, as noted by Hey and Nielsen (2007), Equation 1 suggests a two-step Monte Carlo integration approximation. This works by first sampling genealogies, times of split, and assignment vectors from π(G, t, a|X), which are then used to approximate the posterior of the demographic parameters π(Φ|X) in a second step (Hey and Nielsen 2007). Although this approach does not provide an estimate of the joint posterior π(Φ, t, a|X), it does provide estimates of the marginal posterior for at (first step), as well as the marginal posterior for Φ, which includes all of the rates parameters for genetic drift and gene flow (second step).

In the first step, a Markov chain Monte Carlo (MCMC) simulation is used to collect samples of <G, t, a> from the posterior π(G, t, a|X) ∝ f(X|G)π(G|t, a)π(t)π(a), harada f(X|G) is the likelihood of the data given the genealogies, π(G|t, a) is the prior probability of the genealogies conditional on the times of split and assignment, π(t) is the prior of the times of split, and π(a) is the prior of the assignment vector. The likelihood f(X|G) is computed using conventional methods, such as by mapping mutations onto G in the case of the infinite-sites mutation model or by parameterizing the mutation process under a finite-sites model and using the pruning algorithm (Felsenstein 1981a). The prior probability π(G|t, a) is obtained by integrating over Φ (Hey and Nielsen 2007), (2) where π(Φ) is the prior distribution for the migration rates and effective population sizes, and π(G|Φ, t, a) is the probability of the genealogies conditional on the parameters and assignment. The calculation of this last term, π(G|Φ, t, a), is based on coalescent theory (Hey and Nielsen 2007 Hey 2010 Sousa və s. 2011) and is actually a fairly tractable function of quantities determined from G, including for each rate component of Φ (1) a count of the number of events across G that the rate pertains to and (2) a sum of the total rate for that parameter across G (see, məs., the appendix to Hey 2010). So too is the solution to the integration in Equation 2 analytical and straightforward. The sample of <G, t, a> values can be used directly to estimate the marginal posterior distributions for ta. Thus, this first step approximates the marginal posterior π(t, a|X), providing estimates for the times of split and assignment of loci into groups.

The second step consists of using the sample of <G, t, a> values to estimate the marginal posterior for Φ. Applying Bayes’ theorem, the conditional probability of the parameters given the genealogies can be simplified to π(Φ|G, t, a) = π(G|Φ, t, a)π(Φ)/π(G|t, a). Given a sample of n genealogies, times of split and assignment from the posterior, (G ( i ) , t ( i ) , a ( i ) ) ∼ π(G, t, a|X) (i = 1, …, n), we estimate the marginal posterior distribution of the drift and migration parameters as (3) Note that the marginal posterior π(Φ|X) is not conditioned on particular values for t və ya a, but is in effect estimated by integrating over these other parameters. In sum, given that the joint posterior π(Φ, t, a|X) can be expressed by Equation 1, we can apply the above two-step procedure to obtain the marginal posterior distributions π(t, a|X) (first step) and π(Φ|X) (second step) and hence estimate all the parameters of interest, including t, a, and Φ.


The data

In our exhaustive search for studies that have compared estimates of QSTFST indices between different populations, we were able to find 18 studies of 20 species, including four unpublished ones, which reported QST estimates (Table 2 see also: 73 83 ). Most of these studies have been conducted in plants (55%), whereas invertebrate (30%) and vertebrate (15%) studies in particular, were scarce (Table 2). QST estimates in a given study have been based, on average, on eight different traits (min–max=1–24), growth related morphological and (juvenile) life history traits dominating (Table 2). FST estimates in most of studies have been based on allozymes, but a few microsatellite, RAPD, as well as one nuclear RFLP and one ribosomal DNA based studies have been conducted (Table 2). One study also reported an estimate of FST based RFLP analysis of mtDNA, which was in agreement (after taking account that the N.e for mtDNA genome is 1/4 of that for nuclear markers see, e.g. 18 ) with values returned from analyses of allozymes and microsatellites ( 55 ). Those few studies which have used more than one marker system to estimate FST return qualitatively ( 34 40 ), or even quantitatively ( 55 see also: 34 Table 2), similar conclusions based on estimates from different marker types. Hence, in accordance with data from a number of studies ( 1 ), this suggests that the choice of markers to estimate FST-values may not be of great concern (but see: 62 29 ).


Why Are They Important in Conservation Genetics?

Microsatellite markers are inherited from both parents, making them useful for parentage analysis (think paternity testing) and population genetic studies. Microsatellite markers are useful for population genetic studies because many are considered highly polymorphic. If a microsatellite locus is polymorphic, it means that there is more than one potential allele at a single locus (a specific marker site). Polymorphic loci can have more than 10, even more than 20 potential alleles in that given population. If populations are truly separate from each other, then these alleles are likely to be present in different frequencies in each population. These different allele frequencies increase the potential to observe genetic differences between populations if they exist.

For example, let’s assume we have two populations that are reproductively isolated, but the microsatellite marker we are using only has one or two alleles present for that locus. In addition, the alleles occur at similar frequencies in both populations. The microsatellite data would suggest that these two populations are either one continuous population, or at least had high levels of gene flow between the populations. In this case, the lack of allelic diversity would limit our ability to detect reproductive isolation. Now, let’s assume we are using a microsatellite marker that has 20 possible alleles (highly polymorphic). This large number of alleles increases the odds that allele frequencies will differ between the populations if reproductive isolation is occurring, thus increasing the likelihood of properly identifying the two populations as separate (reproductively isolated from each other). In addition, if the data from the highly polymorphic locus still leads to the conclusion that the two populations are not reproductively isolated, then there would be stronger genetic support suggesting the two populations were either one population or had large amounts of gene flow. In reality, data from multiple microsatellite markers, not just one locus, are used to characterize populations.

Similarly, in parentage analysis, highly polymorphic loci increase our ability to identify individuals. In this case, the large number of alleles increases the likelihood that each individual will have a unique genotype (considering their genotype across multiple loci) relative to other individuals in the population. Similar to population studies, multiple loci are typically used in parentage analysis.

What can cause these differences in allele frequency between populations? Gene flow between populations can act to make allele frequencies more similar, even at low rates of exchange. Genetic drift, a random process, can cause allele frequencies to fluctuate within a population from one generation to the next. New alleles also can arise as a result of a mutation, resulting in the alteration in the number of repeating segments (increasing or decreasing the number of repeats). For example, the ATAGATAGATAGATAGATAGATAGATAGATAG in the figure above could be shortened to ATAGATAGATAG.


Videoya baxın: Vicdan nədir? İçimizdəki səsi nə zaman eşidirik? Söhbətgah. Münasibət #2 (Yanvar 2023).