Məlumat

Euxromatin heterokromatinə çevrilə bilərmi?

Euxromatin heterokromatinə çevrilə bilərmi?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Mən bunu bilirəm Heterokromatin euxromatinə çevrilə bilər Amma mümkün olan tərsdir? Əgər belədirsə, onda necə?


Gələcəkdə soruşmadan əvvəl az miqdarda araşdırma aparmağı təklif edərdim. Məsələn, euchromatin üçün vikipediya səhifəsində belə deyilir:

Euchromatin, mRNA məhsullarına DNT -nin aktiv transkripsiyasında iştirak edir. Açılmamış quruluş, gen tənzimləyici zülalların və RNA polimeraz komplekslərinin DNT ardıcıllığına bağlanmasına imkan verir ki, bu da transkripsiya prosesinə başlaya bilər. Bütün euchromatin mütləq transkripsiya edilmir, lakin ümumiyyətlə istifadə edilmədikdə genləri qorumaq üçün heterokromatinə çevrilmir. Bu səbəbdən bir hüceyrənin nə qədər aktiv məhsuldar olması və nüvəsində tapıla biləcək evromatinin miqdarı ilə birbaşa əlaqəsi vardır. Hüceyrənin genin ifadəsi və replikasiyasına nəzarət üsulu olaraq euchromatin -dən heterochromatin -ə çevrilməsini istifadə etdiyi düşünülür, çünki bu cür proseslər 'əlçatanlıq hipotezi' olaraq bilinən sıx sıxılmış kromatində fərqli davranır. "Həmişə açılan" qurucu euchromatinin bir nümunəsi, hüceyrə həyatının əsas funksiyaları üçün lazım olan zülalları kodlayan ev qulluqçu genləridir.

Fakultativ heterokromatin, şəraitdən asılı olaraq irəli və geri çevrilən xromatindir. Bu, xromatinin (de) "kondensasiyası" və ya (de) "sıxılması" yolu ilə baş verir:

Heterokromatinin yayılmasını tənzimləyən molekulyar komponentlər arasında Polycomb qrupu zülalları və Xist kimi kodlaşdırmayan genlər var. Belə yayılma mexanizmi hələ də mübahisə mövzusudur. [19] Polycomb repressiv kompleksləri PRC1 və PRC2, xromatinin sıxılmasını və gen ifadəsini tənzimləyir və inkişaf proseslərində əsas rol oynayır.

Bu səhifələri bir az oxumağı və cavab vermədikləri təqdirdə daha konkret bir sual verməyi təklif edərdim.


Euchromatin və Heterochromatin arasındakı fərq

Vücudumuz milyardlarla hüceyrədən ibarətdir. Tipik bir hüceyrədə bir nüvə, nüvədə isə xromatin var. Biyokimyaçıların fikrincə, xromatinin əməliyyat tərifi eukaryotik parçalanmış interfaza nüvələrindən çıxarılan DNT, zülal, RNT kompleksidir. Onlara görə, xromatin, ümumiyyətlə histon kimi tanınan paketlənmiş xüsusi zülallardan əmələ gələn bir məhsuldur. Sadə dildə desək, xromatin ilk növbədə deoksiribonuklein turşusunun və ya sadəcə DNT və digər zülal növlərinin birləşməsidir. Xromatin, DNT -ni hüceyrənin içinə sığması üçün daha kiçik həcmlərə yığmaqdan məsuldur. Mitoz və mayozun baş verməsi üçün DNT-ni gücləndirməkdən də məsuldur. Kromatin eyni zamanda DNT -nin zədələnməsinin qarşısını alır və DNT -nin gen ifadəsini və replikasiyasını idarə edir.

İki növ xromatin var. Bunlar evromatin və heterokromatindir. Bu iki forma, hər bir formanın nə qədər intensiv şəkildə boyanması ilə məşğul olan sitoloji şəkildə fərqlənir. Euchromatin heterokromatindən daha az intensivdir. Bu, yalnız heterokromatinin daha sıx DNT paketinə malik olduğunu göstərir. Euchromatin və heterochromatin arasındakı fərq haqqında daha çox məlumat əldə etmək üçün bu məqalə sizə bu iki xromatin forması ilə bağlı tez bir nəzər salacaqdır.

Yüngül qablaşdırılan materiala euchromatin deyilir. DNT, RNT və zülal şəklində yüngül şəkildə qablaşdırılsa da, mütləq gen konsentrasiyası ilə zəngindir və adətən aktiv transkripsiya altındadır. Ökaryotları və prokaryotları araşdıracaqsınızsa, evromatinin varlığını görəcəksiniz. Heterokromatin yalnız eukaryotlarda olur. Ləkələndikdə və optik mikroskop altında müşahidə edildikdə, euchromatin açıq rəngli lentlərə bənzəyir, heterokromatin isə tünd rənglidir. Evromatinin standart quruluşu açılmış, uzanmış və yalnız 10 nanometrlik mikrofibrilə bərabərdir. Bu dəqiqə xromatin, mRNA məhsullarına DNT -nin transkripsiyasında işləyir. Gen tənzimləyici zülallar, o cümlədən RNT polimeraza kompleksləri, euxromatinin açılmamış strukturu sayəsində DNT ardıcıllığı ilə bağlana bilir. Bu maddələr artıq bağlandıqda, transkripsiya prosesi başlayır. Evromatinin fəaliyyəti hüceyrələrin sağ qalmasına kömək edir.

Digər tərəfdən, heterokromatin sıx bir şəkildə yığılmış bir DNT formasıdır. Çox vaxt nüvənin periferik sahələrində olur. Bəzi araşdırmalara görə, ehtimal ki, iki və ya daha çox heterokromatin vəziyyəti vardır. Aktiv olmayan peyk ardıcıllıqları heterokromatinin əsas tərkib hissələridir. Heterokromatin, gen tənzimlənməsindən və xromosom bütövlüyünün qorunmasından məsuldur. Bu rollar sıx DNT paketi sayəsində mümkün olmuşdur. İki ana hüceyrə bir ana hüceyrədən ayrıldıqda, heterokromatin ümumiyyətlə miras alınır, yəni yeni klonlanmış heterokromatin eyni DNT bölgələrini ehtiva edir və bu da epigenetik irsiyyətlə nəticələnir. Sərhəd sahələrinə görə transkripsiya edilə bilən materialların repressiyasının baş verməsi ola bilər. Bu fenomen müxtəlif səviyyəli gen ifadəsinin inkişafına səbəb ola bilər.

Aşağıdakı xülasə, xromatinin iki forması haqqında daha aydın bir anlayış təmin edir: euchromatin və heterochromatin.

Kromatin nüvəni təşkil edir. DNT və zülaldan ibarətdir.

Kromatinin iki forması var: euchromatin və heterochromatin.

Optik mikroskop altında ləkələndikdə və müşahidə edildikdə, euchromatinlər açıq rəngli zolaqlar, heterokromatinlər isə tünd rəngli zolaqlardır.

Daha qaranlıq boyanma, daha sıx DNT paketlənməsini göstərir. Beləliklə, heterokromatinlər euxromatinlərdən daha sıx DNT qablaşdırmasına malikdirlər.

Heterokromatinlər kompakt şəkildə bükülmüş bölgələrdir, eukromatinlər isə sərbəst əyilmiş bölgələrdir.

Euchromatin daha az DNT, heterokromatin isə daha çox DNT ehtiva edir.

Euchromatin erkən replikativdir, heterokromatin isə gec replikativdir.

Euchromatin, eukaryotlarda, nüvəli hüceyrələrdə və prokaryotlarda, nüvəsiz hüceyrələrdə olur.

Heterokromatin yalnız eukaryotlarda olur.

Euchromatin və heterokromatinin funksiyaları gen ifadəsi, gen repressiyası və DNT transkripsiyasıdır.


Heterokromatin quruluşu: qönçələnən mayadan dərslər

Ökaryotik genomu, struktur və funksional olaraq fərqlənən euchromatin və heterochromatin sahələrinə bölmək olar. Heteroxromatin yüksək kompaktlığı və gen ifadəsi kimi DNT əməliyyatlarına inhibitor təsiri ilə xarakterizə olunur. Heterokromatinin əmələ gəlməsi xüsusi histon modifikasiyaları və susdurucu komplekslərin toplanması və yayılmasını əhatə edir və xromatinin birincili və daha yüksək dərəcəli strukturlarında dəyişikliklərə səbəb olur. Son iyirmi il, heterokromatinin histon kodunun, habelə yazıçı və silicilərin (histon dəyişdirən fermentlər) və oxucuların (histon dəyişikliklərini tanıyan amilləri susdurması) təyin edilməsi səbəbindən heterokromatinin molekulyar aspektlərini araşdırmaqda dramatik irəliləyişlər gördü. Heterokromatik histon modifikasiyalarının və susdurma faktorlarının heterokromatinin xüsusi birincil və daha yüksək dərəcəli strukturlarına necə töhfə verdiyini anlamağa başladılar. Qönçələnən maya Saccharomyces cerevisiae uzun müddət heterokromatin tədqiqatları üçün model orqanizm kimi istifadə edilmişdir. Bu tədqiqatların nəticələri heterokromatinin əmələ gəlməsini, saxlanmasını və funksiyasını tənzimləyən ümumi prinsiplərin aydınlaşdırılmasına əhəmiyyətli dərəcədə kömək etmişdir. Bu baxış S. cerevisiae-də heterokromatinin struktur aspektlərinin araşdırılmasına yönəlib. Heterokromatinin digər aspektləri, genin susdurulmasını və epigenetik irsiyyətini necə təşviq etdiyini də əhatə edən qısa anlayışlar qısa şəkildə ümumiləşdirilmişdir.

Açar sözlər: Saccharomyces cerevisiae Sir zülalları heterokromatin yüksək dərəcəli xromatin strukturu transkripsiya susdurulması.


Heterokromatin və evromatin arasındakı əsas fərqlər

Heteroxromatin və euchromatin arasında fərqləndirmək üçün əsas məqamlar bunlardır:

  1. Xromosomda sıx şəkildə yığılmış DNT formasına deyilir heterokromatin, DNT-nin xromosomdakı boş şəkildə yığılmış forması isə adlanır euxromatin.
  2. Heterokromatində, DNT sıxlığı edir yüksək və var tünd rəngə boyanmışdır, euchromatində isə DNT -nin sıxlığıdır az və var yüngülcələkələnmiş.
  3. Heterokromatindir tapıldı Yalnız eukaryotik hüceyrələrdə nüvənin periferiyasında, Euchromatin isə yerləşmişdir prokaryotiklərin nüvəsinin daxili bədənində, eləcə də eukaryotik hüceyrələrdə.
  4. Heterokromatin az və ya göstərir transkripsiya fəaliyyəti yoxdur onlar da var genetik cəhətdən qeyri-aktiv, digər tərəfdən, Euchromatin fəal şəkildə transkripsiya prosesində iştirak edir və olur genetik cəhətdən aktivdir həm də
  5. Heterokromatindir kompakt şəkildə bükülmüşdür vədir gec replikativ, Euchromatin isə boş bükülmüşerkən replikativ.
  6. Regionlar heterokromatin yapışqan, lakin evromatinin sahələri yapışqan deyil.
  7. Heterokromatin hissəsində fenotip Euchromatin-də genetik proses zamanı DNT-də təsirə görə variasiya görünsə də, orqanizm dəyişməz olaraq qalır.
  8. Heterokromatin buna imkan verir gen ifadəsinin tənzimlənməsi və həmçinin Euchromatin nəticəsində hüceyrənin struktur bütövlüyünü qoruyur genetik dəyişikliklər, və genetik transkripsiyaya imkan verir.

Nəticə

Xromatinlə bağlı yuxarıdakı məlumatlardan onların quruluşu və növləri. Heteroxromatin və onun növləri o qədər də əhəmiyyətli rol oynamasa da, transkripsiya prosesində yalnız Euchromatin fəal iştirak etdiyini söyləyə bilərik.

Qurucu heterokromatin peyk DNT-ni ehtiva edir və sentromeri əhatə edir və fakultativ heterokromatin parçalanır. Eukaryotik hüceyrələrin və onların daxili quruluşunun nisbətən kompleks olduğunu söyləmək olar.


Sitat: Hughes SE, Hawley RS (2009) Heterokromatin: Sürətlə İnkişaf edən Növlər Baryeri. PLoS Biol 7 (10): e1000233. https://doi.org/10.1371/journal.pbio.1000233

Nəşr olundu: 27 oktyabr 2009-cu il

Müəlliflik hüququ: © 2009 Hughes, Hawley. Bu, Creative Commons Attribution Lisenziyasının şərtlərinə uyğun olaraq paylanmış açıq girişli məqalədir və orijinal müəllif və mənbə qeyd olunmaqla istənilən mühitdə məhdudiyyətsiz istifadə, paylama və reproduksiyaya icazə verir.

Rəqabətli maraqlar: Müəlliflər heç bir rəqabət aparan maraqların olmadığını bəyan ediblər.

Təxminən 100 il əvvəl bioloqlar xromosomların bölgələrini görünüşlərinə görə iki növə, euxromatin və heterokromatinə böldülər ([1]-də nəzərdən keçirilir). DNT -nin ilkin təsnifatı, eukromatik bölgələrin hüceyrə bölünmə dövrü ərzində kondensasiya dərəcələrini dəyişdirdiyini, heteroxromatik bölgələrin isə hüceyrə dövrünün əksəriyyətində yüksək sıxlaşma vəziyyətində qaldığını müşahidə etməyə əsaslanmışdır. Heterokromatinin bioloji əhəmiyyəti uzun illər qaranlıq qalsa da, heterokromatinin son zamanlar spesifikasiyada müəyyən edilmiş rolu da daxil olmaqla bir sıra bioloji rollar oynadığı aydındır. Xromosomların kondensasiyası zamanı fərqliliklərə əlavə olaraq, evromatin və heterokromatin arasında çoxsaylı digər fərqlər də müəyyən edilmişdir. Euchromatin unikal kodlaşdırma ardıcıllığı ilə zənginləşdirilmişdir və euchromatin daxilindəki genlər adətən aktiv şəkildə transkripsiya edilir. Digər tərəfdən, heterokromatin, peyk sekansları və/və ya köçürülən elementlər kimi çox təkrarlanan sadə ardıcıllıqlardan ibarət olan gen yoxsul hesab olunur. Heterokromatin sentromerlərdə (bax Şəkil 1) və xromosomların telomerlərində zənginləşdirilmişdir.

Göstərilən, həm qatılaşdırılmış heterokromatik (tünd boz), həm də daha az qatılaşdırılmış euxromatik bölgələri (açıq boz) ehtiva edən nümayəndəli akrocentrik xromosomdur. Hər bölgənin yanında hər bir xromatin növü üçün xarakterik xüsusiyyətlər vardır.

Bir sıra xromatin modifikasiyaları, xüsusi olaraq heterokromatin və ya evromatinlə əlaqələndirilir, məsələn, histonlarda spesifik metilasiya nümunələri. Heteroxromatin ilə əlaqəli histon metilasiya nümunələrinin yaradılmasında iştirak edən zülallar, həmçinin heteroxromatin zülalı 1 (HP1) kimi zülallar, heteroxromatinin formalaşmasında və gen susdurulmasında iştirak edən zülallar üstünlük olaraq heteroxromatik DNT-də lokallaşdırılmışdır. Nəhayət, heterokromatin sürətlə inkişaf edir, belə ki, hətta yaxından əlaqəli növlərdən heterokromatik bölgələrin ardıcıl tərkibi tez -tez fərqlənir. Heterokromatindəki genlərin azlığı və sürətli təkamülü, 20 -ci əsrin bir çox elm adamını heterokromatinə sentromerləri və telomerləri ehtiva etməkdən və bəlkə də qorumaqdan başqa, bioloji əhəmiyyəti az olan "zibil" DNT -dən başqa bir şey görməməyə vadar etdi.

Meyvə milçəyi Drosophila melanogaster və yaxın qohumları heterokromatinin təbiətini və əmələ gəlməsini öyrənmək üçün məşhur modellər olmuşdur ([1] də nəzərdən keçirilmişdir). Bu növlərdə, evromatin, iki növ DNT -nin kondensasiyasındakı fərqlər səbəbiylə, mitoloji xromosomların sentromerlərini əhatə edən perisentrik heterokromatindən asanlıqla fərqləndirilə bilər. Üstəlik, heterokromatik bölgələr, larva tüpürcək bezlərində sıx bağlı olaraq qalan, çox təkrarlanan xromosomlar olan polytene xromosomlarında çoxalmır. Bu, evromatin və heterokromatin arasındakı qovşağın kifayət qədər dəqiq bir şəkildə ayrılmasına imkan verir. Əlavə olaraq, D. melanogaster genetik ekranlar aparmaq və irəli genetik manipulyasiyalar aparmaq üçün yüksək dərəcədə işlək bir sistemdir. Çünki həm heterokromatin, həm də evromatin asanlıqla genetik olaraq parçalanır D. melanogaster, bu orqanizmdən istifadə edərək heterokromatinin biologiyası intensiv şəkildə tədqiq edilmişdir.

Doğrudan da, işləyin D. melanogaster heterokromatinin "zibil" DNT olaraq qəbul edilməsinə etiraz etməyə başladı və heterokromatinin bir sıra vacib hüceyrə funksiyalarını oynadığını nümayiş etdirdi. Heterokromatin üçün bir "funksiyanın" ilk əlamətləri, meoz zamanı rekombinasiyada vasitəçilik etməkdə heterokromatinin çoxsaylı rollarının öyrənilməsindən irəli gəlir [2], [3]. Bəlkə də daha tənqidi olaraq, normal eukromatik genləri heterokromatinin yanına yerləşdirmək, bu genlərin dəyişkən susmasına səbəb olur, bu da mövqe-təsir rəngi və ya PEV olaraq bilinir ([1] də nəzərdən keçirilmişdir). Bu susdurma təsiri və düzgün transkripsiya üçün bəzi genlərin heterokromatində olması faktı, heterokromatinin gen tənzimlənməsinin qlobal nəzarətində kritik rol oynaya biləcəyini göstərir [4] - [6].

Bundan əlavə, Karpen, Dernburq, Hawley və onların əməkdaşlarının təcrübələri göstərdi ki, qadın meiozu zamanı rekombinasiyaya uğramayan xromosomların düzgün ayrılması üçün heteroxromatik bölgələrin cütləşməsi tələb olunur [7]-[9]. Sonrakı işlər, rekombinasiyaya uğramayan xromosomların ( X4 -cü ) oositlərdə prometafaz I zamanı heteroxromatik iplərlə bağlanır və bu iplər, ehtimal ki, heteroxromatinin rekombinant olmayan xromosomların seqreqasiyasını asanlaşdıran mexanizmin bir hissəsidir [10].

Meyoz zamanı hər ikisinin spermasında xromosomları birləşdirən ipliklərə dair sübutlar D. melanogaster və kran milçəkləri, meyoz zamanı xromosomların ayrılmasında ipə bənzər quruluşlar üçün qorunmuş bir funksiya təklif edir [11], [12]. Bu ipliklərin heterokromatindən ibarət olub -olmadığı hələ müəyyən edilməsə də, heterokromatində yerləşən rDNA -nın təkrarlanan intergenik boşluq bölgəsinin düzgün birləşməsi üçün tələb olunur. Y ilə xromosom X kişi meyozu zamanı xromosom D. melanogaster [13]. Nəhayət, məməlilərin hüceyrələrində mitoz zamanı xromosomların heterokromatik sentromer bölgələrindən çıxan oxşar iplik növləri müşahidə edilmişdir ki, bu da heterokromatik ipliklərin mitoz zamanı xromosomların ayrılmasında mühüm rol oynadığını göstərir [14], [15].

Hemoz və mitozda heterokromatik ardıcıllığın kritik funksiyalarını və təkamül boyunca ardıcıllıqla sürətli dəyişməsini nəzərə alsaq, heterokromatik ardıcıllıqlarda və ya onları qoruyan zülallardakı fərqlərin növ təcridində rol oynaya bilməsi təəccüblü ola bilməz [16]. Qohum növlərin cütləşməsi bəzən nəslin bir və ya hər iki cinsinin ölümünə və ya sonsuzluğuna səbəb olur ki, bu da hibrid uyğunsuzluğu kimi tanınır. Hibrid uyğunsuzluq onilliklər ərzində tədqiq olunsa da, bunun əsasını təşkil edən molekulyar mexanizmlər haqqında yalnız bir neçə fikir var və bu hallar məlumdur. Drosophila növləri, hibrid uyğunsuzluğu zülal kodlayan genləri əhatə etmişdir [17], [18]. Lakin, bu məsələdə PLoS Biologiyası Ferree və Barbash heteroxromatinin sürətli divergensiyasının reproduktiv izolyasiyanın saxlanmasında da mühüm rol oynadığını nümayiş etdirirlər. D. melanogaster qardaş növdən Drosophila modelləri [16]. Arasındakı xaç D. simulanlar qadınlar və D. melanogaster kişilərin qeyri -adi haldır ki, kişi nəslinin canlı olması mümkündür, ancaq dişilərin embronik inkişafı zamanı ölür [19]. (Adətən hibrid uyğunsuzluq hallarında, yalnız bir cinsin steril və ya öldürücü olduğu halda, heteroqametik kişilər təsirlənmiş cinsdir.)

Ferree və Barbash hibrid qadın embrionlarda mitoz bölünmə 10-13 [16] zamanı uğursuzluqlar nəticəsində ölümcül olduğunu tapdılar. Bu qadınlarda, xromosom bölgələri bu mitotik bölünmələrin anafazası zamanı tez -tez çox uzanır və digər xromosomlardan geri qalırdı [16]. Gecikən DNT, mitoz zamanı bacısından düzgün ayrılmadı, bu da xromosomların düzgün olmayan seqreqasiyasına, anormal mitotik bölünmələrə və nəticədə qadın embrionlarının ölümünə səbəb oldu.

Müəlliflər flüoresan in situ hibridləşdirmədən istifadə edərək, geridə qalan xromatinin ilk növbədə heteroxromatik və yüksək təkrarlanan 359-bp təkrardan ibarət olduğunu müəyyən etdilər. X dən xromosom D. melanogaster ata [16]. Bu heterokromatik təkrarlama növü fərqli bir ardıcıllıq tərkibinə malikdir və tərkibində çox azdır D. simulanlar. 359-bp təkrarlanan bölgə D. melanoqaster X xromosom da üst -üstə düşür Zhr lokus, genetik bir bölgə olduğu üçün təyin edildiyi müəyyən edildi D. melanoqaster X xromosoma icazə verilir D. melanogaster erkəklər keçdikdə həyat qabiliyyətli hibrid qızlar doğurur D. simulanlar qadınlar [19].

Hibrid qadınlarda ölümcüllüyün heterokromatik bir bölgənin bütövlüyünün qorunmaması nəticəsində ortaya çıxması. D. melanogaster X 359-bp təkrarlama ardıcıllığını ehtiva edən xromosom, xromosomun geridə qalması və ölümcül olması ehtimalını ortaya qoyur. D. melanogaster X Qadın hibridlərində xromosomal heterokromatin meydana gəlir D. simulanlar ana tərəfindən təmin edilən 359-bp təkrar bölgəsinin mitozu zamanı düzgün saxlanılması və ya ayrılması üçün lazım olan bir protein və ya RNT molekulu təmin edə bilmir. D. melanogaster ata (bax Şəkil 2). Hətta təsəvvür etmək olar ki, burada müşahidə edilən mitotik seqreqasiyanın uğursuzluğu həm mitotik, həm də meiotik hüceyrələrdə perisentromerik heterokromatini birləşdirmək üçün müşahidə olunan heteroxromatik iplərin düzgün həll edilməməsini əks etdirir (yuxarıya bax).

Bu model Ferree və Barbash-ın bu sayında dərc olunmuş məqalənin nəticələrinə əsaslanır PLoS Biologiyası [16]. Arasında bir xaç D. melanogaster kişilər və D. simulanlar Embriogenezdə erkən ölən hibrid qadınlarla nəticələnən dişilər sağda göstərilmişdir. Soldakı rəsm arasında xaç təsvir edilmişdir D. melanogaster kişilərə D. melanogaster Müqayisə üçün qadınlar. Sadəlik üçün yalnız X xromosomlar göstərilir və heteroxromatik bölgə daha tünd rənglə müəyyən edilir. Hər iki xaçda sperma və yumurtanın birləşməsi nəticəsində bir cüt daşıyan zigotlarla nəticələnir X xromosomlar. ilə xaç D. melanogaster qadın embrionlarında mitotik bölünmələrin 10-13 anafazasında normal xromosom seqreqasiyasına səbəb olur. İlə xaçda D. simulanlar Dişi mitoz hibrid qadın embrionlarında normal şəkildə tamamlanmır. Ana olanda X xromosomlar normal olaraq əks mil qütblərinə doğru ayrılır, ata tərəfindən əldə edilən sentromerlər X xromosomlar xromatin körpüsü ilə bağlanır. Heteroxromatik olan və 359-bp təkrarla zəngin bir bölgədən ibarət olan bu körpü, bacı xromatidlərin düzgün seqreqasiyasına səbəb olur. X xromosom, nəticədə aberrant mitotik bölünmələrə və nəticədə qadın hibrid embrionlarının ölümünə səbəb olan bir hadisə. 359-bp bölgəsinin geriləməsi və ya köprülənməsi, ehtimal ki, anada yüklənmiş bir faktorun olmaması ilə əlaqədardır. D. simulanlar yumurta (içərisində sarı almaz kimi göstərilmişdir D. melanogaster yumurta). Təsəvvür edirik ki, bu amil normal hüceyrələrdə həm mitotik, həm də meiotik xromosomların perisentromerik bölgələrini birləşdirdiyi sübut edilmiş heteroxromatik iplərin həllində iştirak edə bilər (təsvir üçün mətnə ​​baxın). Bu faktorun olmaması, qadın hibrid embrionlarında 359-bp təkrar bölgəsində xromatin quruluşunun düzgün formalaşmasına və ya saxlanmasına mane olur.

Müəlliflər bundan şübhələnirdilər D. simulanlar ya heterokromatik stabilliyi qorumaq və ya heterokromatik əlaqələri həll etmək üçün lazım olan bir faktordan məhrumdur D. melanogaster X embrion mitotik bölünmələr zamanı xromosom heterokromatin. Həqiqətən də, uyğun mitoz üçün lazım olan bir ferment olan topoizomeraz II, hibrid embrionlarda gecikmiş DNT -də qeyri -müəyyən bir lokalizasiya göstərdi. Digər zülalların və ya RNT molekullarının yoxluğunu və ya anormal şəkildə lokalizasiyasını müəyyən etmək üçün əlavə işlər tələb olunacaq D. simulanlar ana sitoplazması və onların olmaması hibrid qadın embrionlarında 359-bp təkrar bölgəsində qüsurlara səbəb olmaq üçün kifayət edərsə.

Bu, hibrid uyğunsuzluğa səbəb olan heterokromatik ardıcıllığın ilk nümunəsi olsa da, ehtimal ki, təbiətdə digər hallara rast gəlinir. Həqiqətən də, bu hibrid yenilməzlik nümunəsi ilə seqreqasiya təhrifi kimi tanınan genetik hadisə arasında paraleli qeyd etməyə bilmərik. D. melanogaster [20]. Bu sistemdə roman mutantı olaraq bilinir SD, xromosomun evromatinində yerləşir 2, homologların meiotik ötürülməsinin qarşısını alır 2 -ci kimi tanınan heteroxromatik elementin yüksək surətini daşıyan xromosomlar Cavab verən (Rsp) [21]. Yanlış kondensasiya və funksiyaya səbəb olan bu fenomenin genetik əsası Rsp-daşıyan spermatidlər yaxşı başa düşülür və bu prosesin tam molekulyar anlayışı əlçatandır. Seqreqasiya təhrifi bir növ təcrid mexanizmi deyil, həqiqətən də "meyotik hərəkət" nümunəsi olsa da, burada qeyd olunur, çünki bir suda bir mutantın digərində heterokromatik bir elementin funksiyasını pozaraq, mexanizmləri göstərən ikinci bir hadisəni göstərir. "heterokromatik uyğunsuzluq" gözləniləndən daha çox ola bilər.

Heteroxromatin sürətlə dəyişdikcə, populyasiyalar müxtəlif mexanizmlərlə təcrid olunduqca onu saxlayan mexanizmlər yaxşı fərqlənə bilər. Əgər bu mexanizmlər A populyasiyasının heterokromatinini B populyasiyasında saxlama zülalları ilə saxlaya bilməyəcək şəkildə dəyişərsə, spesifikasiya getdikcə heterokromatinin özü həmin populyasiyalar arasında bir maneəyə çevrilir. Həm yuxarıda təsvir edilən hibrid sarsılmazlıq sistemi baxımından, həm də heteroxromatik bütövlüyün qorunmasının digər növləşmə nümunələrinin əsasında dayanma dərəcəsini qiymətləndirmək baxımından daha bir çox suallar araşdırılacaq. Ancaq bir şey aydındır: əgər heterokromatinin hər hansı bir hissəsi həqiqətən "zibildir", onda hər ikisinin yaxşı baxılması lazım olan "zibil" və qonşularından bir növ ayıran "zibil" dir.


Transkripsiya aktiv mikroemulsiyaya bənzər evromatini təşkil edir

Kromatin, transkripsiya baxımından aktiv olmayan heterokromatinə və transkripsiyadan aktiv və qeyri -aktiv vəziyyətə keçə bilən evromatinə bölünür. Euchromatin aktivliyindəki bu keçid onun məkan paylanmasında dəyişikliklərlə müşayiət olunur. Evromatinin necə düzəldildiyi bilinmir. Burada transkripsiyada aktiv olmayan euchromatinin transkripsiya aktiv euchromatindən uzaqlaşdığını göstərmək üçün super qətnamə və canlı hüceyrə mikroskopiyasından istifadə edirik. Bu hərəkət, aktiv olmayan euchromatini istisna edən RNT ilə zənginləşdirilmiş mikro mühitlərin meydana gəlməsindən qaynaqlanır. Nəzəriyyədən istifadə edərək göstəririk ki, RNT ilə zənginləşdirilmiş mikromühitlərə və euxromatin domenlərinə seqreqasiya aktiv mikroemulsiya hesab edilə bilər. Transkriptlərin RNA polimeraz II vasitəsi ilə xromatinə bağlanması, iki ayrılmış mərhələni kəsən təsirli amfifilləri əmələ gətirir. Əvvəlki təcrübələrlə birlikdə götürdükdə məlumatlarımız xromatinin aşağıdakı şəkildə təşkil olunduğunu göstərir: heteroxromatin faza ayrılması ilə euxromatindən ayrılır, transkripsiya isə aktiv mikroemulsiyaya bənzər euxromatini təşkil edir.


Mücərrəd

Heterokromatin, eukaryotik xromosomların spesifik funksional xüsusiyyətlərə malik olan xüsusi genomik sahələrini bəxş edən əsas memarlıq xüsusiyyətidir. Heterokromatinin mobil elementlərin fəaliyyətini məhdudlaşdırmaq, təkrarlanan bölgələrdə DNT təmirini təcrid etmək və dəqiq xromosom seqreqasiyasını təmin etmək qabiliyyəti genom stabilliyinin qorunması üçün çox vacibdir. Heterokromatin bölgələrindəki nukleosomlar, soyun spesifik gen ifadəsini məhdudlaşdıraraq inkişaf tənzimlənməsinə töhfə verən histon post-translational dəyişiklikləri göstərir. Heterokromatinin qurulması və heterokromatinin saxlanılması mexanizmləri ayrılır və yeni yaranan transkriptlərə bağlı olan ardıcıllığa xas faktorların xromatini dəyişdirən fermentləri işə götürmə qabiliyyətini əhatə edir. Heterokromatin, nukleasiya yerlərindən xromatin boyunca yayıla bilər. Heterokromatinin öz yayılmasını və irsiyyətini təşviq etmə meyli inhibitor faktorlar tərəfindən qarşısı alınır. Xromosom funksiyası üçün əhəmiyyətinə görə, heterokromatin müxtəlif insan xəstəliklərinin patogenezində əsas rollara malikdir. Bu araşdırmada, bir hüceyrəli model orqanizmlərdən əldə edilən anlayışlara diqqət yetirərək, mayadan insana qədər bir sıra ökaryotların tədqiqatlarından seçilmiş nümunələrdən istifadə edərək heterokromatin əmələ gəlməsinin və funksiyasının qorunmuş prinsiplərini müzakirə edirik.


Xromosomların təşkili

Natella I. Enukashvily, Nikita V. Ponomartsev, Protein Kimyası və Struktur Biologiyasında Avanslar, 2013

1. Giriş

1928 -ci ildə, Heitz uyğun xromosom ləkələri ilə aşkar edilə bilən fərqlər üçün euchromatin və heterochromatin (HC) terminlərini təklif etdi (Heitz, 1928). Bir neçə növ yosun hüceyrələrini karmin sirkə turşusu ilə boyadı və nüvədə hüceyrə dövrü boyunca qatılaşmış qalan bir növ xromatin müşahidə etdi. Heitz, nüvə kromatininin qalan hissəsini hüceyrə interfazası boyunca qatılaşmış bir vəziyyətdə saxlayan (yəni qaranlıq ləkəli görünən) heterokromatin olaraq təsvir etdi, nüvə kromatinin qalan hissəsi isə evromatin vəziyyətinə deyildi. Cooper (1959), Drosophila'dan alınan məlumatları ümumiləşdirməyi bacardı və heterokromatin və evromatinin biofiziki uyğunluqları və genlərinin metabolik ifadəsi ilə fərqləndiyini, lakin xromosomlar içərisində yerləşmiş DNT -nin əsas quruluşu ilə fərqlənmədiyini irəli sürdü. İndi iki növ fərqli qablaşdırılmış xromatindən ibarət eukaryotik genom anlayışı geniş şəkildə qəbul edilir və biologiya üzrə məktəb dərsliklərinə daxil edilir. Heterokromatin termini əvvəlcə sitoloji olaraq interfazada sıxlaşan mitotik xromosomların bölgələri olaraq təyin olunsa da, indi gen repressiyası və susması kimi xarakterik xüsusiyyətləri göstərən xromosomların bölgələrini daxil etmək daha sərbəst şəkildə tətbiq olunur (Craig tərəfindən nəzərdən keçirilmiş, 2005 Lohe və Hilliker, 1995).

Ümumiyyətlə qəbul edilir ki, heterokromatinin iki növü var - konstitutiv və fakultativ. Yaradıcı HC -nin inkişaf yolu ilə tənzimlənən fakültativ HC -dən fərqli olaraq bütün hüceyrə dövrü boyunca qatılaşdırıldığı düşünülür. Mitotik xromosomlarda, qurucu heterokromatik bölgələr ən çox sentromerik və perisentromerik bölgələrdə, eləcə də telomerlərin yaxınlığında yerləşir. 1, 9, 16 və Y xromosomlarında böyük heterokromatin blokları var. Fakultativ HC müxtəlif xromosom bölgələrində əmələ gələ bilər. Məməli qadınlarda, bir X-xromosomu (ana və ya ata tərəfindən törədilmiş) erkən embrion hüceyrələrində təsadüfi olaraq inaktivləşir və bütün sonrakı hüceyrələrdə sabit inaktivasiya olur (Lyon, 1961). Fakültativ HC, transkripsiya edilməyən genlərin təbliğatçı bölgələrində yarana bilər (Rand & amp Cedar, 2003). Bu günə qədər məlum olan bəzi neosentromerlər (sentromerlərin xüsusiyyətlərini əldə edən eukromatik DNT bölgələri) euchromatik bölgələrdə əmələ gəlsələr də heterokromatizasiyaya məruz qala bilərlər (Amor & amp Choo, 2002 Saffery et al., 2003).


Euxromatin funksiyası

Fəal araşdırılmalarına baxmayaraq, xromatinin quruluşu hələ də yaxşı öyrənilməmişdir, baxmayaraq ki, görünür ki, hüceyrənin müəyyən bir dövrədə olduğu dövr kromatinin quruluşunu müəyyən edir. Euchromatinin quruluşu, funksiyası və transkripsiyalı aktiv hüceyrələrdə niyə mövcud olduğuna dair göstərişlər verməsi təəccüblü deyil. Yuxarıda qeyd edildiyi kimi, euchromatin də simlə bağlanmış muncuq boyunbağı ilə bağlayıcı DNT vasitəsilə bağlanan nukleosomlar arasındakı oxşarlığa görə simli muncuq adlanır. Bu uyğunlaşmada euxromatin boşdur və nəticədə bağlayıcı DNT-ni açıq vəziyyətdə qoyur ki, bu şəkildə transkripsiya olunsun, RNT və DNT polimerazları, eləcə də digər zülallar DNT-yə daxil ola bilsin. Boş quruluşuna görə, euxromatini mikroskop altında görmək çətindir və sıx şəkildə yığılmış, asanlıqla görünən heterokromatindən fərqli olaraq, ləkələndikdə zəif görünür.


MATERİALLAR VƏ METODLAR

Bioloji nümunələr üçün OI-DIC görüntü sistemi

OI-DIC mikroskop sisteminin əsas sxemi Şəkil 1A-da göstərilmişdir. Mikroskopun tərkibinə bant keçirmə filtri, kəsişmiş xətti polarizator və analizator, faza dəyişdirici, kondensator və obyektiv linzalar, boru linzası və şarj qoşulmuş cihaz (CCD) rəqəmsal kamerası olan işıq mənbəyi daxildir. Adi DIC görüntüləmə məhdudiyyətlərini aşmaq üçün mikroskopda iki şüa kəsmə qurğusu var (Shribak, 2014). Hər bir montaj iki eyni DIC prizmasından və 90 ° qütbləşmə rotatorundan ibarətdir. Rotatorlar tərəfindən fırlanan işığın polarizasiyası, nümunələri (məsələn, canlı hüceyrələr) və ya prizmaları mexaniki olaraq fırlanmadan kəsmə istiqamətlərini sürətlə 90 ° dəyişdirməyə imkan verir. OI-DIC mikroskopundan istifadə edərək, iki perpendikulyar kəsmə istiqaməti və üç meylli ± 0.15λ və 0 olan altı xam şəkil çəkdik, burada λ dalğa uzunluğudur. Çəkilən OI-DIC şəkilləri, intensivliyi xətti olaraq OPD dəyərinə uyğun gələn OPD şəkillərinə (xəritələrə) çevrildi. Şəkil emalı evdə hazırlanmış bir proqram (OIDIC.exe) istifadə etməklə həyata keçirildi. Bu və digər emal alqoritmləri daha əvvəl təsvir edilmişdir (Shribak and Inoue, 2006 Shribak, 2013 Shribak və s., 2017).

OI-DIC-i Phi Optics (Champaign, IL) tərəfindən istehsal edilən CellVista SLIM Pro faza Xəritəçəkmə mikroskopu ilə müqayisə etmək üçün Fisher Permount montajına maye kristal ekranlarda aralıq kimi istifadə olunan 7 mikron diametrli şüşə çubuqlar quraşdırdıq. orta (Fisher Scientific, https://www.fishersci.com). Şüşə çubuqların və 546 nm dalğa uzunluğunda Permount mühitinin RI -ləri sırasıyla 1.56 və 1.524 -dir. Şəkillər 100 ×/1.4 NA yağlı daldırma obyektiv linzalarından istifadə edilərək əldə edilib. CellVista SLIM, fərqli yanaşmalarda dörd fazalı kontrastlı şəkilləri çəkdi və işlədi.

Hüceyrə tərkibinin sıxlığının qiymətləndirilməsi

Zülalların və nuklein turşularının RI-lərinin kalibrləmə əyrilərini əldə etmək üçün (Əlavə Şəkil S3), iribuynuzlu serum albümini (BSA Sigma A-9418) və qızılbalıq sperma DNT (Fisher Scientific BP-2514) 0 konsentrasiyalarda hüceyrə mühitində həll edildi. -200 və 0-30 mq/ml. Hazırlanmış standart həllərin RI-ləri Abbé-3L (Bausch & amp Lomb) refraktometri ilə ölçülmüşdür. The measured RIs and solution densities were plotted and fitted with linear functions to obtain calibration curves.

We estimated intracellular density distribution from obtained OPD maps using the following two steps (Figure 1B). First, we calculated the RI from the OPD. Because the OPD is proportional to the thickness of a sample and the difference in RI between the sample and the surrounding solution, as shown in Figure 1B, we calculated the RI of samples on the basis of the RI of the surrounding solution and sample thickness. Second, we obtained the dry mass density (“density” for short) of the sample from its RI, because the RI of a sample is proportional to its density. For proteins and nucleic acids, which are the dominant materials in mammalian cells (>60% of dry mass) (Alberts və s., 2007), our calibration curves (Supplemental Figure S3 see above) of RI versus dry mass density using BSA and salmon sperm DNA showed that both were well fitted to linear functions and were almost identical (RI = 1.3375 + 1.4 × 10 –4 × C, harada C is dry mass density). Therefore, dry mass density in live cells, which consists mainly of proteins and nucleic acids, was calculated from their RI using a single calibration curve (Supplemental Figure S3). To estimate the densities of the total cell contents, we measured the average thickness of the cytoplasm and nucleus in each cell line (Supplemental Figure S1, A and B). The pericentric foci were assumed to be spherical (Supplemental Figure S1C). To obtain the RI of cytoplasm (RIcy), we used the RI of the surrounding culture medium (RImed, 1.3375) (Supplemental Figure S2). For the RIs of the nucleus and the pericentric foci, we used our calculated values of RIcy and RInuc, respectively (Supplemental Figure S2). These estimates were created using ImageJ software.

EGFP-MeCP2 construction

A plasmid containing MeCP2-EGFP was kindly provided by M.C. Cardoso (Brero və s., 2005). The moiety of MeCP2-EGFP was cut by XhoMən və XbaI enzymes and blunted. The blunted fragment was inserted into the EkoRV site of the pEF5/FRT/VS-DEST Gateway Vector (Invitrogen) to generate pEF5-MeCP2-EGFP-FRT.

EGFP-mH3.1p-H3.1 construction

A mouse histone H3.1 promoter (∼840 base pairs)-H3.1 fragment was amplified from mouse embryonic stem (ES) cell genomic DNA by PCR using the following primer set:

5′-AGCCCTCTCCCCGCGGATGCGGCGGGCCAGCTGGATG­TCC-3′. The amplified fragment was cloned into an EGFP vector to obtain pmH3.1p-H3.1-EGFP. Then two more insert sequences were prepared. One was the H3.1promoter-H3.1-EGFP amplified from the pmH3.1p-H3.1-EGFP vector using the following primer set:

and 5′-TTACTTGTACAGCTCGTCCATGCCGAGAGT-3′. The other was the 3′ untranslated region of H3.1 (∼500 base pairs) amplified from the mouse ES genome using the primer pair: 5′-TGGACGAGC­TGTACAAGTAAAGTTCGTCTTTCTGTGTTTTTCAAA­GGCTC-3′

For backbone vector preparation, the region from the EF1α-promoter to the BGH polyadenylation signal sequence was removed from pEF5/V5-FRT Gateway (Invitrogen) to create the pFRT-Hygromycin vector. The pFRT-Hygromycin vector, H3.1promoter-H3.1-EGFP sequence, and 3′ untranslated region sequence were ligated by SLIC (Li and Elledge, 2007) to prepare the pmH3.1p-H3.1-EGFP-3′UTR-FRT plasmid. In addition, upstream of the H3.1 promoter, an insulator fragment (tandem cHS4 kindly provided by G. Felsenfeld) was inserted to obtain pIx2-mH3.1p-H3.1-EGFP-3′UTR-FRT.

EGFP-fibrillarin construction

To clone the fibrillarin gene, total RNA was isolated from NIH3T3 cells using the RNeasy Mini Kit (Qiagen), and first-strand cDNA was synthesized using the SuperScript III First-Strand Synthesis System (Thermo) with oligo(dT). The coding region of fibrillarin was amplified from the first-strand cDNA using the following primer pair: 5′-GGGGTACCATGAAGCCAGGTTTCAGCCC-3′ and 5′-GCGGGA­TCCTCAGTTCTTCACCTTGGGAG-3′. The amplified fragment was digested with KpnMən və BamHI and ligated into KpnI/BamHI-digested pEGFP-C1 (Clontech, Palo Alto, CA). EGFP-fibrillarin fragments were excised, blunt-ended using T4 DNA polymerase (Takara, Japan), and inserted into EkoRV-precut pEF1-FRT to generate pEF1-EGFP-fibrillarin-FRT.

Cell culture and stable cell lines

We used RPE1, a human cell line, and NIH3T3, a mouse cell line. All of the cell lines were maintained in DMEM (Lonza) supplemented with 10% (vol/vol) fetal bovine serum (FBS) and 0.584 g/l l -glutamine (Sigma) at 37°C with 5% CO2 in air in a humidified incubator. To establish NIH3T3 cells expressing MeCP2-EGFP, EGFP-fibrillarin, or H3.1-EGFP, we used the Flp-In system (Invitrogen) as previously described (Maeshima və s., 2010 Hihara və s., 2012).

OI-DIC microscopy system

Details of the microcopy system are provided in the Supplemental Material.

Live-cell OI-DIC microscopy imaging

Cells were seeded on 24 mm × 24 mm square glass coverslips coated with poly d -lysine (Sigma) and cultured for 1–2 d. Then 30 min before imaging, 500 ng/ml Hoechst 33342 was added into the media and incubated further. The cells were mounted on a glass slide with a thin silicone spacer. We observed the mounted cells by OI-DIC and fluorescence imaging.

OI-DIC imaging of glass rods

A small number of glass rods 4 µm in diameter were suspended in two types of mineral oil with refractive indices of 1.54 and 1.58. Approximately 2 µl of the suspended solution was sandwiched between a glass slide and a coverslip, and then sealed with nail polish. The glass rods in the mineral oil were analyzed by OI-DIC microscopy using the same procedure as the live cell imaging.

Fiksasiya

For formaldehyde fixation, cells on the square glass coverslips were washed once with phosphate-buffered saline (PBS), and then fixed in 4% formaldehyde at room temperature for 15 min. The fixed cells were washed with 10 mM HEPES-KOH, pH 7.5, 100 mM KCl, and 1 mM MgCl2 (HMK) (Maeshima və s., 2006) and permeabilized with 0.5% Triton X-100 in HMK at room temperature for 5 min. The treated cells were washed with HMK, stained with 500 ng/ml Hoechst 33342 in HMK at room temperature for 10 min, and then washed again with HMK. For MeOH fixation, cells on coverslips were fixed in ice-cold MeOH at –20°C for 30 min. Then the fixed cells were washed with HMK at room temperature for 15 min, stained with 500 ng/ml Hoechst 33342 in HMK for 10 min, and washed again with HMK. Finally, the cells were mounted on a glass slide and observed as described above.

Immunostaining of histone H3K9me3

Immunostaining was performed as previously described (Maeshima və s., 2010 Hihara və s., 2012). Cells were fixed in 2% formaldehyde (Wako) and permeabilized with Triton X-100. The primary and secondary antibodies were mouse anti-H3K9me3 (a generous gift from Hiroshi Kimura) and Alexa-Fluor-594-conjugated goat anti-mouse immunoglobulin G (Invitrogen) used at dilutions of 1:500 and 1:1000, respectively. Then DAPI (500 ng/ml) was added to the cells for 5 min, followed by washing with PBS prior to DNA staining. Images were obtained using a DeltaVision microscopy imaging system (Applied Precision) or a FLUOVIEW FV1000 confocal laser scanning microscope (OLYMPUS).

Measurements of cell thicknesses

Live RPE1 and NIH3T3 cells were seeded on 35 mm glass-bottom dishes. To fluorescently label DNA and cytoplasm, cells were incubated in culture medium containing 0.5 µg/ml Hoechst 33342 (Dojindo) and 5 µg/ml Calcein-AM (Dojindo) for 30 min. After washing out excess fluorescent dye, the stained cells were observed under an OLYMPUS FLUOVIEW FV1000 confocal laser scanning microscope equipped with a 60 ×/1.2 NA water objective. Hoechst 33342 and Calcein-AM fluorescence signals were acquired as three-dimensional image stacks (500 nm × 32 sections). The thicknesses of three regions (nucleus, cytoplasm, entire cell see Supplemental Figure S1) were measured in each cell line from the acquired stack images by ImageJ software.

Measurement of nuclear volume of live cells

Image stacks of live NIH3T3 and RPE1 cells acquired to measure cell thickness (described above) were used. The images were converted into binary images by auto thresholding in ImageJ software. Then the volumes of binary image stacks were analyzed using the 3D Objects Counter ImageJ plugin (Bolte and Cordelieres, 2006).

Quantification of fluorescence from Hoechst-stained DNA, MeCP2-EGFP, and α-H3K9me3

Image stacks of live or immunostained NIH3T3 cells (described above) were used. The middle sections of Hoechst-stained nuclei were selected from the z-stack images. The highest intensity of a focal plane of heterochromatin and the mean intensity of the surrounding low-intensity region in a nucleus were taken as the intensities of heterochromatin and the surrounding euchromatin. These values were adjusted to account for the background intensity.

Composition estimation of euchromatin and heterochromatin in live cells

The genome size of diploid mouse cells is 5.6 × 10 9 base pairs. Because 1 pg of DNA is 978 × 10 6 base pairs (978 × 10 6 base pairs/pg), the mass of the whole mouse genome is 5.73 pg. If we assume that nucleosomes (core histones + DNA) form every 200 base pairs of the genome and that the mass ratio of core histones to DNA is around 1:1, the mass of the nucleosomes in a mouse nucleus is 11.5 pg (5.73 × 2). The average mouse nuclear volume was calculated to be ∼1000 µm 3 (Supplemental Figure S6B), and the density of nucleosomes in mouse euchromatin was calculated to be 11.5 mg/ml. Further estimates are described under Nəticələr.

Monte Carlo simulation

Monte Carlo simulation is a computational algorithm that performs a numerical integration by making a random movement and evaluating whether the movement is acceptable based on the change in potential energy (Hibino və s., 2017). All of the molecules in the simulations were treated as hard spherical bodies. We employed a Metropolis Monte Carlo method without long-range potential or hydrodynamic interactions to determine the diffusive motion of molecules (Morelli and ten Wolde, 2008). The diameters and diffusion coefficients (Ds) of the crowding agents used in the simulations were 9.6 nm and 9 µm 2 s −1 , respectively, which are comparable to those of a single nucleosome molecule. The Ds of tracers (spheres with diameters of 5, 10, 15, and 20 nm) were 18, 9, 6, and 4.5 µm 2 s −1 , respectively. Bunlar Ds were determined by the Stokes–Einstein relationship based on parameters from the EGFP monomer, the diameter and D of which were 3.8 nm and 23.5 µm 2 s −1 , respectively (Hihara və s., 2012). Simulations were conducted in a 210-nm cubic box with two compartments (left and right halves) with periodic boundaries to avoid problems caused by finite space, and make the system more like an infinite one. For the “nucleosomes only” scenario, which corresponds to 11.5 mg/ml (euchromatin) and 85.9 mg/ml (heterochromatin), 134 and 968 copies of 9.6 nm spheres (crowding agents) were randomly placed in the left and right halves of the box, respectively. These crowding agents mimicked nucleosomes displaced less than 5 nm from their initial positions at t = 0 s (the “dog on a leash” model see also Hihara və s., 2012, and Maeshima və s., 2015). Then 50 tracers that could diffuse freely were placed in the left (euchromatin) region. The motion of the molecules was iteratively simulated following previously described procedures (Hihara və s., 2012 Maeshima və s., 2015). For the second simulation (nucleosomes + nonnucleosomal materials), 1578 and 1578–3945 9.6 nm spheres (crowding agents) were randomly placed in the left and right regions of the box, respectively, to represent euchromatin and heterochromatin (1.53–2.5-fold density differences). To represent nucleosomes, 134- and 968 9.6-nm spheres were randomly placed in the left and right regions, with their behavior following the “dog on a leash” model. The rest of the spheres moved freely only in each half, to represent diffusing proteins and RNAs. Then 50 tracers were placed in the left (euchromatin) region. Although the simulation process was similar to the first simulation, we restricted the movements of crowding agents to within their regions to keep the density of each region constant. Results were obtained by averaging 150 samples from three independent trials. The simulation time step, Δt, was 10 ns.

Statistik təhlillər

All of the statistical analyses were performed using the two-tailed Student’s t sınaq səh values less than 0.05 were considered statistically significant.