Məlumat

PCR üçün primerlər təkrarlana bilərmi?

PCR üçün primerlər təkrarlana bilərmi?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Başlanğıc sualını burada tamamlayın, gülməyin: Əgər sintez edilmiş bəzi primerlərim varsa və tükənmək üzrəyəmsə, onları təkrarlamaq / gücləndirmək / daha çoxunu özüm sintez etmək üçün hər hansı bir yol varmı? Mən ardıcıllıqları bilmirəm. Yoxsa daha çox almaq mənim yeganə seçimimdir? Təşəkkürlər


Qısa cavab: Bir az daha almalısınız, amma sifariş üçün də ardıcıllığa ehtiyacınız var.

Uzun cavab: Taq polimeraza reaksiyanı işə salmaq və DNT zəncirini genişləndirə bilmək üçün bir parça DNT (və ya RNT) lazımdır, buna görə də biz ilk növbədə primerlərdən istifadə edirik (həmçinin istədiyimiz bölgəyə reaksiyanın spesifikliyini təmin etmək üçün) gücləndirmək). Reaksiyanı aktivləşdirmək üçün təxminən eyni uzunluqda (və ya ən azından çox qısa) istifadə etdiyinizə uyğun bir astar lazımdır, buna görə əslində heç bir məna daşımır, çünki özünüzü düzəltmək üçün bir astarınız olmalıdır. astar. Astarlar bu gün ucuz olduğundan, daha çox sifariş edin.


Dəniz fermentləri və xüsusi maddələr mübadiləsi - A hissəsi

Michael F. Freeman, Enzimologiyada Metodlar, 2018

2.2.2 Buferlər, məhlullar və reagentlər

Plazmid pLMB51 (Addgene #40083)

Füzyon DNT polimeraz və təchiz olunmuş tampon

Deoksiribonukleotidlər (dNTPs, 10 mM hər biri)

0,5 μg/ml etidium bromid və ya ekvivalenti olan TAE agaroz geli, TAE tamponu (40 m)M Tris, 20 mM sirkə turşusu, 1 mM EDTA, pH 8.0)

Məhdudiyyət fermentləri BamHI-HF, XbaI, BglII, SpeI-HF və əlaqəli tamponlar

E. coli DH5α kimi klonlama ştammı

Lizogeniya bulyonu (LB) orta və 100 μg/ml ampisilinli LB-agar plitələri (son konsentrasiyası)


Sahəyə yönəldilmiş mutagenezdə təkrarlanan mutagensis astar - (07 oktyabr/2013)

Enzinomics EZ-MIX dəstindən istifadə edərək maraq geni sahəsində nöqtə mutasiyası yaratmağa çalışıram. İnanıram ki, bu dəstə, primerin ortasında mutasiyanın tətbiqi ilə irəli dəyişən tamamlayıcı primerin sürətli dəyişmə sahəsinə yönəldilmiş mutagenez üsulu ilə PCR gücləndirməsini izləyir və dpn1 həzmini izləyir.

Transformasiyadan sonra koloniyalar əldə edə bilərəm, amma iki klonu ardıcıllığa göndərdiyim zaman nəticələnir ki, hər iki klonda bütün mutagenez astarının təkrarlanan bölgəsi var. Kiminsə belə bir təcrübəsi olubsa və bu problemi necə həll edəcəyimi bilə bilərəm. Ardıcıllıq üçün daha çox klon göndərməyi düşünürəm. Təşəkkürlər!

Qeyd etməliyəm ki, nöqtə mutasiyasını əldə edə bilirəm, amma bütün primer bölgə təkrarlanır. təşəkkürlər !!

Geninizdə mutasiyanızın iki dublikatının olduğunu nəzərdə tutursunuz? Nə demək istədiyinizi başa düşməkdə çətinlik çəkirəm.

Düşünürəm ki, nəticəsində təkrarlanan mutagenez primerlərini tamamlayan bir ardıcıllığa sahib olduğunu söyləyir. Yəqin ki, onun istədiyi mutasiya da daxildir.

Bunun necə baş verəcəyini yalnız iki şəkildə təsəvvür edə bilərəm, mutasiya sahəsinin yaxınlığındakı ardıcıllıq çox oxşardır və primerlər onlara bağlanır, amma bu polimarerasiya prosesi ilə uyğun gəlmir. Digəri, ehtimal ki, ucları bir -birini tamamlayan və bakteriya hüceyrələrindəki plazmid təmiri zamanı ardıcıllıqla təkrarlanan yerlərdir.

Qətiliklə daha çox klon sınayın. Ancaq heç olmasa astar sıralarını yerləşdirə bilsəydiniz, problemin primer olub olmadığını söyləmək olardı.

Cavab üçün təşəkkürlər. Sahəyə yönəldilmiş mutagenez üçün istifadə etdiyim primerlər əlavə edilmişdir. Qırmızı rəngli üçlü kodon, orijinal TAC üçlü kodonu əvəzinə təqdim etdiyim nöqtə mutasiyasıdır. Mən primeri özüm tərtib edirəm və primer sayta yönəldilmiş mutagenezdə tələb olunduğu kimi təmizlənmir.

5 ’- AAACAAATTTG TTG ATTGGGTTCTT

Bu bütövlükdə 25bp primer çevrildikdən sonra koloniyaların ardıcıllığında təkrarlanır və ya üç dəfə təkrarlanır. Məsələn, cinah yerinə-AAACAAATTTG TTG ATTGGGTTCTT-yan tərəfə, indi yan tərəfə çevrilir-AAACAAATTTG TTG ATTGGGTTCTTAAACAAATTTG TTG ATTGGGTTCTT-cinah. Daha çox klon ekranım var idi, lakin normal klonları tapa bilmədim. Qismən bölgə əvəzinə bütün bölgə təkrarlandığından, bunun astarlanma səbəbindən əmin deyiləm.

Kimsə mənə təklif verə bilsə, minnətdar olaram. Çox sağ ol

Astarın bir neçə dəfə mükəmməl bir şəkildə daxil edilməsini qəribədir.   Bir dimer proqnozlaşdırma proqramı ilə işləyərkən iki astarın bağlanmasını görə bilərsiniz, ancaq gördüklərinizlə uyğun gəlmir:

Thermo Scientific, Self-Dimers:

Qoşma saytınızın 5 və 3 'bölgələri birdən çox əlavə etməyə icazə verən oxşardır?

Mutagenez dəsti 25bp primerin 2bp mutasiya üçün kifayət olduğunu söyləyirmi? Düzgün mutasiya üçün protokollarım ümumiyyətlə gt40bp tələb edir.

Nəticələriniz ən azından qəribədir.   3 'və 5' gen ardıcıllığınız haqqında bir sıra məlumat verə bilərsinizmi?

Bu məsələnin həlli üçün heç bir qərar varmı? Yeni fikirlər varmı? Mən indicə sayta yönəldilmiş mutagenez həyata keçirdim və eyni fenomeni - mutantın daxil olduğu ardıcıllığın təkrarını yaşayıram. .

Düşünmürəm ki, hər hansı bir həll var idi - amma mənə elə gəlir ki, OP-nin primerlərinin bəzi əlavələri ola bilər ki, bu da potensial olaraq maraq saytının təkrarlanmasına səbəb ola bilər.

Bunu dəfələrlə müşahidə etmişəm. Daha çox koloniya yoxlamaqdan başqa bir həll tapmadım. Bu baş verəndə, sıralamaq üçün göndərdiyim 5 koloniyadan 1 -i idi. Mən tövsiyə olunandan daha yüksək konsentrasiyalı primer istifadə edirəm. Normal PCR ilə müqayisədə çox yüksək olan reaksiyada təxminən 4-5 uM astar istifadə edirəm. Bunun niyə baş verdiyini təxmin etməli olsaydım, düşünürəm ki, astarın yüksək konsentrasiyası bu qəribə nəticəyə səbəb ola bilər.


Polimeraz Zəncir Reaksiyası (PCR): PCR haqqında Biologiya Qeydləri

PCR, in vitro DNT sintezi ilə xüsusi və şəfalı DNT ardıcıllığının eksponensial gücləndirilməsi üçün sadə və dahiyanə bir üsul təqdim edir, yəni bu texnika böyük miqdarda DNT fraqmentlərini klonlaşdırmadan sintez etməyə imkan verir.

1985-ci ildə Kary Mulis, Taq DNT polimeraza adlı bir fermentin istifadəsinə əsaslanan texnikanı inkişaf etdirdi. PCR texnikası artıq avtomatlaşdırılmışdır və xüsusi və utancaq şəkildə hazırlanmış maşın tərəfindən həyata keçirilir.

Texnika aşağıdakı üç addımı əhatə edir (Şəkil 22.16):

i. DNT fraqmentinin denatürasiyası:

Gücləndiriləcək ardıcıllığı ehtiva edən hədəf DNT, tamamlayıcı iplərini ayırmaq üçün istilik denaturasiyadır (15 saniyə ərzində 94 ° C ətrafında), bu prosesə hədəf DNT -nin əriməsi deyilir.

ii. Astarların tavlanması:

Primerlər həddindən artıq əlavə edilir və temperatur 60 saniyə ərzində təxminən 68°C-ə endirilir, nəticədə primerlər hidrogen bağları yaradır və DNT ardıcıllığının hər iki tərəfində DNT-yə bağlanır.

Nəhayət, fərqli nukleozid trifosfat (dATP, dGTP, dCTP, dTTP) və termo-stabil DNT polimeraz (Thermus aquaticusdan Taq polimeraz və Thermococcus litoralisdən Vent polimeraz) reaksiya qarışığına əlavə olunur, bu da primerlərin polimerləşmə prosesinə kömək edir və , hədəf DNT ardıcıllığının çoxlu nüsxələrinin sintezində nəticə verən primerləri (68°C-də) genişləndirir.

Bütün bu addımlar bir dövrədə tamamlandıqdan sonra eyni prosesdən sonra yenidən ikinci dövrə təkrarlanır. Əgər 20 belə sikl baş verərsə, o zaman hədəf DNT ardıcıllığının təxminən bir milyon nüsxəsi istehsal olunur. Son zamanlarda bu texnologiya daha da təkmilləşdirildi, burada Taq polimerazın əvəzinə RNT -ni DNT -yə köçürən və sonra DNT -ni gücləndirən rTth polimeraz istifadə olunur.

Dəyişdirilmiş PCR formaları:

Ənənəvi PCR simmetrik PCR texnikasıdır. Müxtəlif məqsədlər üçün istifadə edilən digər dəyişdirilmiş PZR formaları var:

AP-PCR (Özbaşına Astarlanmış Polimeraz Zəncir Reaksiyası):

Bu, PCR-də istifadə olunan primerlərlə müqayisədə nisbətən daha kiçik uzunluqda yalnız bir primer tələb edir. Bu texnologiyadan DNT profilinin yaradılmasında, heyvan və bitki biotexnologiyasında, eləcə də məhkəmə tibbdə istifadə olunur.

Bir zəncirinin hədəf ardıcıllığı və ardıcıllığı tamamlayıcı zəncirlə müqayisədə bir neçə miqyasda gücləndirilə bilər. Bu yanaşma DNT-nin ardıcıllığı üçün istifadə ediləcək tək zəncirli DNT fraqmentinin yaradılması üçün xüsusilə faydalıdır.

IPCR (Ters çevrilmiş polimeraz zəncirvari reaksiya):

Bu üsul, bilinən bir DNT ardıcıllığı ilə əhatə olunan DNT -nin amplifikasiyasına və qurulmasına imkan verir, primerlər xaricə baxır. Tərs PCR istifadə edərək, bilinən ardıcıllığı əhatə edən naməlum ardıcıllıqlar asanlıqla gücləndirilə bilər.

RT-PCR (əks transkriptaza polimeraza zəncirvari reaksiya):

PCR amplifikasiyası ümumiyyətlə DNT şablonu üzərində aparılır, lakin bu texnikadan istifadə edərək RNT də amplifikasiya üçün istifadə edilə bilər. Bu texnika genlərin ifadəsini öyrənmək və gizlətmək və mRNT-nin qaranlıq növlərini izləmək üçün xüsusilə faydalıdır.

Yuvalanmış PCR primerləri birinci primer cütünün daxili olanlardır. PCR -in birinci turunun istehsal etdiyi daha böyük fraqmentlər ikinci PCR üçün şablon kimi istifadə olunur. Bu texnika hər hansı bir saxta qeyri-spesifik gücləndirmə məhsulunu aradan qaldırır.

Biotexnologiyada PCR tətbiqi:

PCR -də bir çox katlama tətbiqi var.

1. Klonlaşdırmanın sürətli alternativi kimi gen fraqmentlərinin gücləndirilməsi:

(a) Bakterial plazmidlərin daxil edilməsi primerlərlə gücləndirilə bilər.

(b) Bilinən ardıcıllıqdakı DNT, astarların dizaynı ilə əldə edilə bilər.

(c) PCR əlaqəli orqanizmlərdən homoloji ardıcıllıqların müəyyən edilməsinə kömək edir.

(d) RT-PCR istifadə edərək cDNA-nın 3 ′ ucu gücləndirilə bilər (RACE: cDNA Ends-in Sürətli Amplifikasiyası).

(e) Əks PCR, məlum DNT klonunun cinah ardıcıllığını bilməyə kömək edir.

2. DNA Fraqmentlərinin Modifikasiyası:

PCR primerləri kimi oliqonukleotidlərdən istifadə edərək sayta yönəldilmiş mutagenez struktur-funksiya əlaqəsini öyrənmək üçün güclü yanaşma təmin edir.

3. Patogen mikroorqanizmin diaqnostikası:

Bir insanın və ya heyvanın yoluxmuş hissələrinin DNT-si patogenin primer spesifik geni ilə PCR-ə məruz qala bilər və DNT-nin gücləndirilməsi ilə diaqnostika və şinoz edilə bilər.

4. Arxeoloji Nümunələrin DNT Analizi:

DNT nisbətən sabit olduğu üçün və uzun müddət pozulmadığı üçün, PCR həmin gömülmüş və parçalanmış materiallardan alınan DNT -nin analizinə kömək edə bilər.

5. İrsi Xəstəliklərə Uyğun Mutasiyanın Saptanması:

Hər hansı bir nöqtə mutasiyası, silinməsi və ya daxil edilməsi və genişlənmiş tandem trinükleotidin təkrarlanması PCR ilə aşkar edilə bilər. Onkogenlər və ya şiş repressor genlərindəki somatik mutasiyalar, əlavə və ya silinmənin yanındakı primerlərlə PCR ilə də aşkar edilə bilər.

6. Məhkəmə Tətbiqləri, atalıq testi və irsi xüsusiyyətlərin xəritələndirilməsi üçün Genetik Markerlərin Təhlili.

(b) ixtiyari, tez-tez qısa (10 bp) primerləri olan RAPD (Random Amplified Polimorphic DNT).

7. SINE ardıcıllığına əsaslanan primerdən istifadə edərək kəsişən təkrar elementlər (IRS) arasında DNT Seqmentlərinin Növlərə Xüsusi Gücləndirilməsi (Qısa Keçidilmiş Nüvə Elementləri).

8. PCR istifadə edərək genetik mühəndislik:

PCR-dən istifadə edərək, biz 5-in sonunda primerə ardıcıllığı dəyişdirərək, silməklə və ya əlavə etməklə son məhsula dəyişiklik və ya mutasiyanı daxil edə bilərik. Rekombinant PCR texnikası ilə bir -birini tamamlayan üst -üstə düşmə yolu ilə spesifik və shyfic bir yerdə iki DNT parçasını birləşdirmək mümkündür (Bu texnikaya birləşmə deyilir). Dəyişdiriləcək daxili sahəni əhatə edən iki mutagen primeri sintez etməklə, bir fraqment daxilində mutasiyaları təqdim etmək mümkündür.


DNT Hazırlanması

Molekulyar klonlaşdırma, bir vektor molekuluna əlavə olaraq DNT -nin daxil edilməsini əhatə edir. Klonlaşdırılacaq DNT, məhdudlaşdırıcı fermentlərlə həzm olunmaqla, mənbə DNT-dən kəsilərək, ya polimeraz zəncirvari reaksiya (PCR) və ya tərs transkripsiya-PCR (RT-PCR) vasitəsi ilə mənbə molekulundan kopyalanaraq əldə edilə bilər. qısa DNT parçalarından (oliqonükleotidlərdən) yığılaraq. Bu metodların hamısı DNT mənbəyinin DNT -nin klonlanması üçün işlənməsində iştirak edən ferment fəaliyyətlərini (endonükleazalar, polimerazlar) potensial olaraq maneə törədə bilən çirkləndiricilərdən kifayət qədər azad olmasını tələb edir.


Endonukleaz həzminin məhdudlaşdırılması ilə ənənəvi klonlaşdırma, bir çox fərqli mənbə DNT növlərindən hər hansı birini istifadə edə bilər. Genomik DNT, bir məhdudlaşdırma fermenti ilə həzm oluna bilər və eyni mənbəli DNT -dən fərqli əlavələr kitabxanası yaratmaq üçün uyğun bir vektor saytına klonlaşdırıla bilər. Artıq bir vektora klonlanmış DNT məhdudlaşdırıcı fermentlərlə DNT-ni kəsərək və ikinci vektorun müvafiq yerlərinə klonlaşdırmaqla yeni alıcı vektora köçürülə (alt klonlaşdırıla bilər). Bu, tez -tez RNT -nin protein ifadəsini və ya transkripsiyasını asanlaşdırmaq üçün edilir, məsələn, orijinal vektordan mümkün olmaya bilər.

PCR tez -tez klonlaşdırmaq üçün DNT yaratmaq üçün istifadə olunur və tez -tez məhdudlaşdırma sahələri primer sahələrə daxil edilir, belə ki, gücləndirilmiş DNT həzm oluna bilər və klonlama vektorunun uyğun məhdudlaşdırıcı yerlərinə klonlaşdırılır. İstənilən ardıcıllığı ehtiva edən istənilən növ DNT PCR üçün şablon kimi xidmət edə bilər. İki fərqli məhdudlaşdırma fermenti ilə klonlaşdırma, hər bir molekulda uyğun olmayan ucların meydana gəlməsini təmin edir və bununla da sadə vektorların təkrar dövriyyəsinin qarşısını alır və əlavələri yönləndirilmiş şəkildə klonlaşdırmağa məcbur edir. Bu, protein ifadəsi üçün tərcüməli açıq oxu çərçivəsini təmin etmək üçün əhəmiyyətli ola bilər. Məhdudlaşdırılmış həzmdən sonra DNT -nin dəyişdirilməsi müəyyən vəziyyətlərdə faydalı ola bilər. Məsələn, tək bir məhdudlaşdırıcı fermentin istifadə edildiyi istiqamətsiz klonlaşdırmada, həzm olunan vektor DNT-nin fosforlaşdırılması vektorun yenidən dövriyyələnməsinə mane olacaq və bununla da istənilən rekombinant DNT molekullarının nisbətini artıracaqdır.

PCR, klonlaşdırma proqramları üçün DNT hazırlamaq üçün getdikcə daha çox istifadə olunur. Gücləndirilmiş DNT ya birbaşa klonlaşdırıla bilər, ya da PCR üçün istifadə olunan primerlərə uyğunlaşdırılmış məhdudlaşdırma sahələri ilə məhdudlaşdırılan həzmdən sonra. Alternativ olaraq, gücləndirilmiş DNT NEBuilder HiFi DNT Assembly və ya Ligation Müstəqil Klonlama kimi Sorunsuz Klonlaşdırma strategiyalarında istifadə edilə bilər. Bu klonlama üsulları üçün vektor molekulları PCR ilə də istehsal oluna bilər. Taq polimeraza ilə gücləndirilmiş DNT, tamamlayıcı T-quyruqlu vektorlara klonlamağa imkan verən 3 və rsquo ucunda əlavə edilmiş şablondan asılı olmayan tək adenozinə (A) malikdir. Yüksək sədaqətlə oxunan polimerazalar, gücləndirilmiş DNT-nin künt uclu məhdudlaşdırma sahələrinə klonlaşdırılmasına imkan verən əlavə əsaslar əlavə etmir. Seçilmiş klonlaşdırma strategiyasından asılı olaraq, gücləndirilmiş DNT-nin ucları A-quyruğu, kütləşmə və ya 5 & rsquo-fosfat qruplarının əlavə edilməsi və ya çıxarılması ilə dəyişdirilə bilər. RNT -nin tərs transkripsiyası nəticəsində yaranan tamamlayıcı DNT (cDNA) da PCR ilə gücləndirilə bilər. RNT şablonlarından DNT sintez etmə qabiliyyəti, gen transkriptlərinə uyğun olan ardıcıllıqların klonlaşdırılmasına imkan verir.


EKSPERİMENTAL PROSEDURLAR

Laboratoriya Bacarıqları -

Bu məşqdə müvəffəqiyyət qazanmaq üçün aşağıdakı texniki bacarıqlar tələb olunur: steril laboratoriya texnikası, dəqiq pipetləmə qabiliyyəti, ferment aktivliyini qorumaq üçün texnika bilikləri, mikrosantrifüjlər və yarı loqarifmik kağızdan istifadə. DNT replikasiyası, PCR və agaroz gel elektroforezi haqqında məlumat faydalıdır, lakin laboratoriya məşğələsindən əvvəl arxa plan mühazirəsində verilə bilər. Tələbələr iki və ya üç qrup halında çalışırlar, qrupun ən azı bir üzvü kişi və biri qadın olmalıdır.

Avadanlıq-

Laboratoriya məşqi üçün bir mikrosantrifüj, iki qızdırıcı su hamamı, gel elektroforez avadanlığı (enerji təchizatı, üfüqi gel qutuları, qablar və taraklar) və tələbə qruplarının sayını yerləşdirmək üçün kifayət qədər tutumlu bir və ya daha çox termosikler lazımdır. DNT zolaqlarını vizuallaşdırmaq üçün ultrabənövşəyi qoruyucu qalxanı olan ultrabənövşəyi işıq mənbəyi lazımdır. Əgər varsa, gelin şəklini hazırlamaq üçün gel sənədləşdirmə cihazı və ya kamera istifadə edilə bilər. Burada təsvir edilən təcrübələr üçün Mastercycler Gradient termosikl cihazı və 5415C mikrosentrifuqa (Eppendorf, Hamburq, Almaniya), Mini-Sub Cell GT PowerPac 300 gel elektroforez sistemi (kataloq № 165-4347 Bio-Rad, Hercules, CA) və IS- 1000 Rəqəmsal Görüntü Sistemi (Alpha Innotech Corp., San Leandro, CA) istifadə edilmişdir.

Kitlər, fermentlər və həllər -

Genomik DNT izolyasiya dəsti (katalo no. SA-40001) və X&Y xromosom astar dəsti dəsti (kataloq nömrəsi SP-10704) Maxim Biotech-dən alınmışdır. Primer dəsti müsbət nəzarət kimi istifadə üçün iki primer, nukleotidlərlə PCR buferi, 100-bp DNT nərdivanı və insan DNT-sini təmin edir. Teorik olaraq, hər bir dəstdə 100 təhlil üçün kifayət qədər material var (33 qrup), lakin hər qrupa artıq həll verildiyindən, bir dəstə təcrübənin əvvəlcədən sınanması da daxil olmaqla üç PCR -nin 20-24 dəstini yerləşdirəcək. Kitdəki 100 bp DNT nərdivanının miqdarı məhdudlaşdırıla bilər, lakin əlavə DNT nərdivanı şirkətdən ayrıca satın alına bilər. Taq polimeraz (5 U/μl) Eppendorfdan alınmışdır. DNA nümunəsi yükləmə tamponu satın alına bilər (kataloq nömrəsi. 161-0767 Bio-Rad) və ya standart protokollara uyğun olaraq hazırlana bilər [9]. Agaroza (SeaKem GTG) BioWhittaker Molecular Applications-dan (Rockland, ME) əldə edilmişdir. Etidium bromid (bir mutagen) 10 mq/ml məhlul (Bio-Rad) şəklində alındı ​​və konsentrat məhlul yalnız müvafiq əlcək taxan təlimatçı və ya müəllim köməkçisi tərəfindən işləndi. Tələbələrə sulandırılmış etidium bromid məhlullarını onun mutagen xassələri barədə xəbərdarlıqları olan əlcəklərdən istifadə etməklə idarə etməyə icazə verildi. Daha az zərərli xüsusiyyətlərə malik digər DNT boyaları da mövcuddur (Gelstar nuklein turşusu ləkəsi FMC, Philadelphia, PA).

Laboratoriya ləvazimatları və quraşdırma-

Hər qrup üçün aşağıdakı təchizatlar tələb olunur: etidiyum bromid, pipet və 2 ilə 1000 μl həcmli steril pipet ucları olan məhlulların işlənməsi üçün əlcəklər, DNT-ni təcrid etmək üçün dörd steril 1.5 ml mikrosantrifüj borusu, iki steril 1 ml pipet ucu ( və ya iki steril tampon) yanaq hüceyrəsi nümunələrinin toplanması üçün, üç 0,5 ml-lik PCR borusu və elektroforez nümunələrinin hazırlanması üçün üç steril 0,5 ml-lik mikrosentrifuqa borusu.

Tələbələrin çox vaxt pipetləmə və aktiv fermentlərlə işləmə təcrübəsi məhdud olduğu üçün, ayrı -ayrı qruplara prosedurda istifadə olunan müxtəlif həllərin alikotlarını vermək faydalı ola bilər. Laboratoriyalarımızda fermentləri ya müəllimin, ya da müəllimin əlavə etməsi də sərfəlidir. Bu tədbirləri görmədən, şagirdlərin pipetləmə səhvləri bəzən stok qablarından bahalı fermentlərin əhəmiyyətli itkilərinə səbəb olur. Alternativ olaraq, Taq polimerazı laboratoriya dövründən dərhal əvvəl optimallaşdırılmış PCR tamponu ilə qarışdırıla bilər və bir PCR tampon/polimeraz qarışığı (30 μl PCR tamponuna 0,2 μl Taq polimeraz) şəklində təqdim edilə bilər.

Tələbələrin hər bir qrupuna etiketlənmiş komponentlərin ayrı-ayrı alikotları olan buz qabı verin (protokolda göstərilən həcmdən 1,2-2 dəfə). Aşağıda göstərilən məhlullar və həcmlər Maxim Biotech genomik DNT təmizləmə dəsti üçün tətbiq edilir. Digər dəstlərdən də istifadə edilə bilər. DNT izolyasiyası üçün (1-ci gün), alikvot hüceyrə lizisi məhlulu (1,5 ml BD-3 məhlulu), ribonukleaza A (buz üzərində 25 μl), zülal çökdürən məhlul (buz üzərində 0,5 ml BD-4 məhlulu) və 100% etanol (Otaq temperaturunda 1,5 ml).

2-ci gün üçün buz kimi 70% etanol (2,5-3 ml), steril distillə edilmiş, deiyonlaşdırılmış su (0,5 ml), X&Y astar dəstindən (40 μl), 10 qat seyreltilmiş insan genomu DNT (15 μl) ) və PCR bufer/polimeraza qarışığı (120 μl). Agaroz gel elektroforezi üçün (3-cü gün) 5 × nuklein turşusu nümunə tamponu (15 μl) və Tris-asetat-EDTA (TAE)12 təmin edin 2 İstifadə olunan abreviatura: TAE, Tris-asetat-EDTA. elektroforez tamponu (300 ml 40 m M Tris asetat, 1 m M EDTA). Həmçinin, 100 μl 100-bp DNA nərdivanı ilə 20 μl nümunə tamponu və hər qrupa 6 μl nisbətində premiks edin. Tələbələrin konsentratlı etidium bromid məhlullarına məruz qalmasını minimuma endirmək üçün müəllim köməkçisi agarozu (TAE tamponunda 1%) laboratoriya müddətindən dərhal əvvəl əridə bilər, 50 ml alikotları istiliyədavamlı birdəfəlik 50 ml-lik borulara yerləşdirə, etidium bromid əlavə edə bilər, və boruları istifadə olunana qədər 65 ° C su banyosunda saxlayın.

Təhlükəsizlik narahatlıqları -

Etidium bromid və bəzi digər DNT boyaları mutagendir. Əlcək geyin və bu maddələrlə təmasdan çəkinin. Qatılaşdırılmış etidiyum bromidlə təmasda olan pipet uclarını düzgün şəkildə atın. Məşqin sonunda bütün bioloji nümunələri avtoklavlayın və fərdi kampusun Ətraf Mühitin Sağlamlığı və Təhlükəsizliyi siyasətinə uyğun olaraq atın.

Eksperimental Prosedurlar -

Genomik DNT təcrid dəsti üçün istehsalçının təlimatları tələbələrə təqdim olunub və prosedur aşağıda ümumiləşdirilib. Ayrı-ayrı kişi və qadın DNT nümunələri hazırlayın. Steril 1 ml pipet ucu və ya steril bir çubuqla hər iki yanağın içini 10 dəfə yumşaq bir şəkildə cızın. Pipetin ucunda bəzi bərk material və tüpürcək görünməlidir. Nümunəni steril 1,5 ml mikrosentrifuqa borusunda 0,6 ml soyuq BD-3 məhlulu (lizis məhlulu) ilə yaxşıca qarışdırın. Lizis məhlulu hüceyrə membranını pozmaq və hüceyrə tərkibini buraxmaq üçün yuyucu vasitə və güclü bir baza ehtiva edir. Nümunəni qarışdıraraq homojenləşdirin və sonra 65 ° C -də 30 dəqiqə inkübe edin. Solüsyonu otaq istiliyinə qədər soyudun və nümunədə olan RNT molekullarını həzm etmək üçün 10 μl RNaz A məhlulu əlavə edin. 37 ° C -də 20 dəqiqə inkübe edin və sonra tüpü buz üzərində 5 dəqiqə saxlayın. Zülalların duzlama təsiri ilə çökməsinə səbəb olan bir duz olan 0,2 ml BD-4 məhlulu əlavə edin. Borunu bir neçə dəfə ters çevirərək yaxşıca qarışdırın və çöküntülü zülalları çıxarmaq üçün maksimum sürətlə bir mikrosantrifüjədə 10 dəqiqə santrifüj edin. DNT olan supernatantı toplayın və təzə 1,5 ml mikrosantrifüj borusuna köçürün. Otaq temperaturunda 0,6 ml 100% etanol əlavə edin və DNT-ni çökdürmək üçün borunu 40-50 dəfə çevirin. Santrifüj borularını növbəti laboratoriya dövrünə qədər 4 °C-də saxlayın.

DNT İzolasiyasının Tamamlanması və PCR Qarışıqlarının Hazırlanması -

DNT izolasiyasını tamamlamaq üçün, boruları maksimum sürətlə 10 dəqiqə santrifüj edin və üst qatını atın. DNT çökməlidir, lakin əksər hallarda görünməyəcək. DNT-ni yumaq üçün boruya 1 ml buzlu 70% etanolu yumşaq bir şəkildə pipetləyin. Borunun tərkibini qarışdırmayın. 5 dəqiqə sentrifuqa edin, supernatantı atın və peletin havada qurumasına icazə verin. 0.2 ml steril distillə edilmiş deionlaşdırılmış su əlavə edin. Tüpü 65 ° C -də 20 dəqiqə qızdırın, inkubasiya zamanı DNT -ni həll etmək üçün bir neçə dəfə ters çevirin. Lazım gələrsə, DNT nümunəsi -20 ° C -də saxlanıla bilər, lakin dəfələrlə dondurulmamalı və əriməməlidir.

Agaroz Gel Elektroforezi

Tələbələrin TAE tamponunda üfüqi 1% agaroz jelləri (7 × 10 sm) hazırlamalarını təmin etmək üçün təlimat və materiallar təqdim edin. Jelləri TAE tamponu olan gel qutularına qoyun. Üç steril mikrosentrifuqa borusunu qadın, kişi və ya nəzarət DNT kimi etiketləyin. Hər boruya 3 μl 5 × nümunə tamponu əlavə edin. Hər bir boru üçün təzə bir ipucu istifadə edərək, müvafiq olaraq etiketlənmiş mikrosantrifüj borusuna 15 μl hər bir PCR əlavə edin. Qısaca qarışdırın. Hər qarışıqdan 15 μl jel üzərində ayrı bir zolağa yükləyin. Dördüncü zolağa DNT nümunəsinin yükləmə tamponu ilə əvvəlcədən qarışdırılmış 5 μl DNT nərdivanı (molekulyar ölçü standartı) əlavə edin. Qapağı gel qutusuna bağlayın və tünd mavi boya gel uzunluğunun yarısından üçdə ikisinə çatana qədər geli işlədin (adətən 100 V-da 45 dəqiqə). Enerji təchizatını söndürün, jeli çıxarın və ultrabənövşəyi işıqla müşahidə olunan bantlama modelini qeyd edin.


PCR PRİMERLƏRİNİ TƏSSİF EDİN

ARKA MƏLUMAT: PCR nəzəriyyəsini izah edən saytlar, eləcə də PCR məhsullarını satan şirkətlər üçün Highveld-i ziyarət etməklə başlamaq istəyə bilərsiniz. PCR üsulları üçün PCRlink.com saytına baxın.

PCR primerlərinin dizaynı üçün bir neçə əla sayt var:

Primer3: WWW astar aləti (Massachusetts Universiteti Tibb Məktəbi, ABŞ) & ndash Bu sayt, arzu olunan məhsulun ölçüsü, primer ölçüsü və Tm diapazonu və 3&rsquo-GC sıxacının mövcudluğu/olmaması daxil olmaqla, primerlərin təbiətinə əhəmiyyətli dərəcədə nəzarət etməyə imkan verən çox güclü PCR primer dizayn proqramına malikdir.
GeneFisher - İnteraktiv PCR Astar Dizaynı (Universitat Bielefeld, Almaniya) - astar dizaynına böyük nəzarət etməyə imkan verən çox yaxşı bir sayt.

Primer3Plus - məşhur Primer3 astar dizayn proqramına yeni bir təkmilləşdirilmiş veb interfeysi (İstinad: A. Untergasser et al. 2007. Nucl. Acids Res. 35(Veb Server problemi): W71-W74)
BiSearch Astar Dizaynı və Axtarış Aləti-bu, hər hansı bir DNT şablonu və xüsusən bisülfitlə işlənmiş genomlar üçün astar dizaynı üçün faydalı bir vasitədir. EPCR aləti, cDNA kitabxanalarında və yerli və ya bisülfitlə müalicə olunan genomlarda səhv yazılmış saytların və alternativ PCR məhsullarının sürətli aşkarlanmasını təmin edir. (İstinad: Ar & aacutenyi T et al. 2006. BMC Bioinformatics 7: 431).

Primer-BLAST istifadəçilərə giriş PCR şablonuna xas olan primerlər hazırlamağa kömək etmək üçün NCBI-də hazırlanmışdır. O, PCR primerlərini dizayn etmək üçün Primer3-dən istifadə edir və sonra onları istifadəçi tərəfindən seçilmiş verilənlər bazasına qarşı BLAST axtarışına təqdim edir. Daha sonra giriş şablonundan başqa hədəflərin gücləndirilməsinə səbəb ola biləcək astar cütlərinin qarşısını almaq üçün partlayış nəticələri avtomatik təhlil edilir.

MFEprimer, istifadəçilərə genomik DNT və peyğəmbər RNT/tamamlayıcı DNT ardıcıllığı məlumat bazalarına qarşı primer spesifikliyi yoxlamağa imkan verir. Bu server, astar bağlama sahələrinin axtarış prosesini sürətləndirmək üçün k-mer indeks alqoritmindən istifadə edir və hər bir primer və onun DNA şablonu arasındakı bağlanma sabitliyini qiymətləndirmək üçün termodinamikdən istifadə edir. Hər bir amplikonun spesifik və ya qeyri-spesifik ardıcıllığı, ərimə temperaturu və ölçüsü kimi bir sıra mühüm xüsusiyyətlər bildirilir. (İstinad: Qu W et al. 2012. Nucl. Acids Res. 40 (Veb Server məsələsi): W205-W208)

Primer Dizayn və Axtarış Aləti

PrimerDesign-M-tədqiqatçılara, bütün HİV-1 genomları kimi uzun DNT hədəflərini əhatə edən və eyni zamanda çoxsaylı uyğunlaşmalarda və təcrübi dizayn məhdudiyyətlərində genetik müxtəliflik ilə məlumatlandırılan primerləri optimallaşdıran gəzinti astarlarını səmərəli şəkildə dizayn etməyə imkan verən çoxlu astarlı dizayn üçün bir neçə variant daxildir. istifadəçi tərəfindən verilir. PrimerDesign-M həmçinin DNT barkodlarını ehtiva edən və primerin dimerləşməsini minimuma endirən primerlər dizayn edə bilər. PrimerDesign-M, çox dəyişkən DNT hədəfləri üçün optimal astarlar tapır və eksperimental şərtlərə uyğunlaşmaq üçün alternativ dizaynlar təklif edərək dizayn elastikliyini asanlaşdırır. (İstinad: Yoon H & amp Leitner T. 2015. Bioinformatika 31:1472-1474).

RF-klonlaşdırma (Kısıtlamasız klonlama)-1990-cı illərin ortalarında Stratagene tərəfindən populyarlaşan QuikChange və ticarət mutagenezi prosesini genişləndirən və hər hansı bir plazmidin hər hansı bir yerində hər hansı bir ardıcıllığın daxil edilməsinə imkan verən PCR əsaslı bir texnologiyadır. ( İstinad: Bond SR & Naus CC. 2012. Nucl. Acids Res. 40(Veb Server məsələsi): W209-W213)

primers4clades-metagenomik DNT-dən və ya istifadəçi tərəfindən təyin olunan filogenetik soylara aid olmayan xarakterik orqanizmlərdən yeni növlərin çoxalması üçün PCR primerlərinin dizaynı üçün bir boru kəməridir. O, kodlaşdıran genlərin həm DNT, həm də zülalın çoxsaylı uyğunlaşmasına əsaslanan genişləndirilmiş CODEHOP strategiyasını həyata keçirir və oliqonukleotid cütlərinin termodinamik xassələrini, həmçinin maksimum ehtimal filogeniyalarının filial dəstək dəyərlərindən hesablanan proqnozlaşdırılan amplikonların filogenetik məlumat məzmununu qiymətləndirir. Ekranda göstərilən ağaclar, astarların interaktiv olaraq seçilmiş örtükləri hədəf almasını asanlaşdırır. (İstinad: Contreras-Moreira B və digərləri. 2009. Nuklein Asidləri Res. 37(Veb Server məsələsi): W95-W100).

TaxMan: rRNA amplikonlarınızı və takson təyinatlarınızı yoxlayın - Mikrobiom analizlərində, tez -tez oxunuşlara taksonomik adlar təyin etmək üçün rRNA gen verilənlər bazalarından istifadə olunur. TaxMan serveri oxuduğunuz məlumatların taksonomik paylanmasının təhlilini iki yolla asanlaşdırır. Birincisi, primerləriniz tərəfindən istehsal olunan ardıcıllıqlara hansı taksonomik adların təyin olunduğunu və hansı taksonları itirəcəyinizi yoxlaya bilərsiniz. İkincisi, FASTA başlığında nəsilləri olan istehsal edilmiş amplikon ardıcıllıqları endirilə bilər. Bu, işləmə vaxtı və yaddaşdan istifadə ilə bağlı daha səmərəli təhlillə nəticələnə bilər, çünki amplikon ardıcıllığı tam uzunluqlu rRNA gen ardıcıllığından xeyli qısadır. Bundan əlavə, siz primerləriniz və istifadə olunan istinad üçün bütün taksonların saylarını ehtiva edən nəsil faylını yükləyə bilərsiniz. (İstinad: Brandt, B.W. et al. 2012. Nükleik Asitlərin Araşdırılması 40:W82-W87).

Oligonükleotid fiziki -kimyəvi parametrləri:

NetPrimer (Premier Biosoft International, ABŞ) Tm, termodinamik xüsusiyyətlər və ən sabit saç tokası və amp dimerləri ilə təmin etdiyi üçün ən yaxşı saytdır, amma fikrimcə proqramın yüklənməsi bir müddət çəkir.

dnaMATE - üç fərqli termodinamik cədvələ əsaslanan birləşmiş metoddan istifadə edərək qısa DNT ardıcıllığı (16-30 nts) üçün konsensus Tm hesablayır. Konsensus Tm dəyəri, molekulyar biologiyada praktik tətbiqin qısa DNT ardıcıllığı üçün ərimə temperaturunun möhkəm və dəqiq bir qiymətləndirilməsidir. Mövcud olan bütün eksperimental məlumatlardan istifadə edən dəqiqlik meyarları, Tm proqnoz səhvlərinin 89% hallarda eksperimental dəyərdən 5 və ordmC daxilində olacağını göstərir. (İstinad: A. Panjkoviç və b. 2005. Nucl. Acids Res. 33: W570-W572.).

OligoCalc - onlayn oliqonukleotid xüsusiyyətləri kalkulyatoru - ( İstinad: W.A. Kibbe. 2007. Nucl. Acids Res. 35(Web Server buraxılışı):W43-W46)
OligoAnalyzer 3.1 (Integrated DNA Technologies, Inc)
Mongo Oligo Kütlə Kalkulyator v2.06
Oliqo Qiymətləndirici (Sigma -Oldrich)
Oligo Hesablama Aləti (Genescript, ABŞ) - dəyişdirməyə imkan verir

Zülal ardıcıllığına əsaslanan PCR primerləri:

Zülal ardıcıllığınız varsa və DNT ardıcıllığını istəyirsinizsə, ən yaxşı saytlar DNT -dən tərs tərcümə və ya Ardıcıllıq Manipulyasiya Suiteinin Tərs Tərcümə hissəsidir. Əgər siz xüsusi amin turşusunu digərinə dəyişdirməkdə maraqlısınızsa, Primaclade ilə məsləhətləşməlisiniz (İstinad: Gadberry MD et al. 2005. Bioinformatika 21:1263-1264).

PCR və klonlama:

AMUSER (Aavtomatlaşdırılmış DNT Milə uyğunlaşdırmalar İSTİFADƏÇİ klonlama) müxtəlif USER klonlaşdırma əsaslı DNT mühəndisliyi üçün optimallaşdırılmış PCR primerlərinin sürətli və asan dizaynını təklif edir. KULLANICI klonlaşdırması, plazmid DNT mühəndisliyi üçün sürətli və çox yönlü bir üsuldur. Bu veb server vasitəsi, bir neçə fərqli İSTİFADƏÇİ klonlaşdırma əsaslı tətbiqlər üçün optimal PCR primerlərinin dizaynını avtomatlaşdırır. İstənilən genetik dəyişikliklər üçün optimal PCR primerlərinin layihələndirilməsi ilə DNT-nin yığılmasını və faktiki olaraq istənilən növ sayta yönəldilmiş mutagenezin tətbiqini asanlaşdırır. (İstinad: Genee HJ et al. 2015. ACS Synth Biol. 4:342-349).

Genomik miqyaslı primerlər: (Qeyd edək ki, əlavə yüklənə bilən proqramlar üçün JAVA səhifəsinə də baxın)

PCR dəsti (Klinische Genetica, Erasmus MC Rotterdam, Hollandiya) - bu, genomik primer dizaynı üçün Primer3-ə əsaslanan dörd proqram paketidir. Hamısı primer xassələri üzərində əhəmiyyətli nəzarət təklif edir:

Overlapping_Primers - bir ardıcıllıqla çoxlu üst -üstə düşən PCR məhsulları yaradır.
Genomic_Primers - genom ardıcıllığı ilə ekzonlar ətrafında astarlar hazırlayır. Sizə lazım olan tək şey geninizi ehtiva edən GenBank faylıdır.
SNP_Primers - GenBank faylında hər SNP ətrafında astarlar hazırlayır.
cDNA_Primers - açıq oxu çərçivələri ətrafında astarlar hazırlayır. Sadəcə olaraq genlərinizi ehtiva edən GenBank faylını yükləyin.

Üst -üstə düşən astar dəstləri:

İki sayt təklif edən proqram, üst -üstə düşən PCR primer cüt dəstləri üçün Primer3 proqramına əsaslanır - Primer 3 və Overlapping Primersets ilə birdən çox Astar Dizaynı.

PHUSER (Primer Hüçün elp İSTİFADƏÇİ ) - Uracil -Xüsusi Eksizyon Reaktifi (KULLANICI) füzyonu, bir neçə sadə addımda çoxlu DNT fraqmentlərinin yığılmasına imkan verən son zamanlarda hazırlanmış bir texnikadır. PHUSER fərdiləşdirilə bilən İSTİFADƏÇİ kasetini ehtiva edən plazmiddə fraqmentlərin düzgün şəkildə birləşməsini təmin edən PCR optimallaşdırılmış primerlərin tez və asan dizaynını təklif edir. Astarlar oxşar yumşalma temperaturuna (Tm) malikdir. PHUSER eyni zamanda eyni çıxıntıların qarşısını alır və bununla da DNT fraqmentlərinin düzgün yığılma qaydasını təmin edir. Mümkün olan bütün primerlər GC tərkibi, 3 ' sonunda GC qısqacının olması, primer dimer əmələ gəlməsi riski, primer içərisində ikincil quruluş riski və polyN uzanmalarının olması baxımından fərdi olaraq təhlil edilir. (İstinad: Olsen LR et al. 2011. Nucl. Acids Res. 39 (Veb Server məsələsi): W61-W70)

Primerize, DNA ardıcıllığı PCR montajının astar dizaynları üçün bir Web Serverdir. Primerize, primer sərhədlərinin səhv düzəldilməsini azaltmaq üçün optimallaşdırılmışdır, RNA problemlərinin sabit ardıcıllığı üçün hazırlanmışdır və geniş və ciddi testlərdən keçmişdir. Bu səmərəli alqoritm, kütləvi paralel mutagenez kitabxanası kimi geniş istifadə üçün uyğundur. (İstinad: Tian, ​​S., & Das, R. (2016) Biofizikanın Rüblük İcmalı 49(e7): 1-30).

Qısa müdaxilə edən RNT (siRNA) dizaynı:

Kiçik müdaxilə edən RNT (siRNA), homolog mRNA-nın ardıcıl olaraq spesifik degradasiyasına rəhbərlik edir, beləliklə & quot; yıxılan & quot; hüceyrələri yaradır. siRNA dizayn vasitəsi, istifadəçi tərəfindən tənzimlənən qaydaları təmin edən namizəd siRNA ardıcıllığı üçün bir hədəf geni tarar. Müxtəlif serverlər mövcuddur:

siRNA Dizayn Proqramı - yuxarıda sadalananlar da daxil olmaqla mövcud dizayn vasitələrini müqayisə edir. Onlar həmçinin səmərəsiz siRNA-ları süzgəcdən keçirə bilən alqoritm vasitəsilə MPI prinsiplərini və mövcud alətləri təkmilləşdirməyə çalışırlar. Alqoritm ikincil quruluşa dair bəzi yeni müşahidələrə əsaslanır. (İstinad: S. M. Yiu və başqaları. (2004) Bioinformatik 21: 144-151).

OligoWalk, hiss-antisens hibridizasiyasının termodinamik xüsusiyyətlərini hesablayan bir onlayn serverdir. Hədəf RNT -yə bağlanan oligonükleotidlərin sərbəst enerji dəyişikliklərini proqnozlaşdırır. Verilmiş bir mRNA ardıcıllığını hədəf alan səmərəli siRNA dizayn etmək üçün istifadə edilə bilər. (İstinad: Lu ZJ & Mathews DH. 2008. Nucl. Acids Res. 36: 640-647).

VIRsiRNApred - insan viral siRNA effektivliyinin proqnozlaşdırılması serveri (İstinad: Qureshi A et al. 2013. J Transl Med. 11:305).

Dicer-substrat siRNAs (DsiRNAs), ənənəvi siRNA-larla müqayisədə RNA müdaxiləsində potensialını artıran 27-mer dupleks RNT-lərdən kimyəvi olaraq sintez olunur.

pssRNAit - Genom miqyasında hədəfdən kənar gen qiymətləndirilməsi ilə effektiv və spesifik bitki RNTi siRNA-larının layihələndirilməsi.

DSIR, siRNA (19 və ya 21 nt) və shRNA hədəf dizaynı üçün bir vasitədir. (İstinad: Vert JP et al. 2006. BMC Bioinformatika 7:520).

Imgenex siRNA retriever proqramı pSuppressor vektorlarından birinə klonlaşdırıla bilən DNT oliqonukleotidləri kodlayan siRNA seçmək üçün nəzərdə tutulmuşdur. Giriş sırasına tədqiqatçı tərəfindən verilən bir Genbank girişindən və ya ardıcıllıqla birbaşa daxil olmaq olar.

siDRM, təsirli siRNA -ları seçmək üçün DRM qayda dəstlərinin tətbiqidir. Müəlliflər, siRecords -dan tərtib edilmiş böyük və müxtəlif bir verilənlər bazasında disjunctive qayda birləşdirmə (DRM) yanaşmasını istifadə edərək, yeni bir onlayn siRNA dizayn vasitəsi olan siDRM -də tətbiq olunan qaydalar dəstini tətbiq etdilər. siDRM həmçinin bir neçə yüksək həssaslıq qayda dəstini və sürətli qayda dəstlərini, siRecords-a keçidləri həyata keçirir və siRNA-ların seçilməsində fitri immun reaksiyalar, hüceyrə zəhərli təsirləri və hədəfdən kənar fəaliyyətlər daxil olmaqla, arzuolunmaz zərərli təsirləri yoxlamaq üçün bir neçə filtrdən istifadə edir. (İstinad: Gong W et al. 2008. Bioinformatika 24:2405-2406).

siMAX siRNA Dizayn Aləti (Eurofins Genomic, Almaniya) - maraqlandığınız genləri hədəf alan ən uyğun siRNA -nı seçməyinizə kömək etmək üçün hazırlanmış xüsusi hazırlanmış bir proqramdır.

shRNA Dizayneri (Biosettia Inc, ABŞ) - SORT-A/B/C vektorlarımıza uyğun olan shRNA oliqoslarını tərtib etmək üçün bu proqramı istifadə edin. Dizayn vasitəsi, geninizi yıxmaq üçün ən böyük şansı olan hədəfləri təmin edir. Diqqət yetirin, palindromik olduğu üçün yalnız bir oligo dizayn edilmişdir.

siDESIGN Mərkəzi (Horizon Discovery Ltd., Böyük Britaniya) - funksional siRNA-nın tanınma ehtimalını əhəmiyyətli dərəcədə yaxşılaşdıran inkişaf etmiş, istifadəçi dostu bir siRNA dizayn vasitəsidir. Hədəf spesifikliyini artırmaq və siRNA dizaynlarını daha mürəkkəb eksperimental dizayn üçün uyğunlaşdırmaq üçün bənzərsiz variantlar mövcuddur.

Real-time PCR primer dizaynı:

RealTimeDesign (Biosearch Technologies) - pulsuz, lakin qeydiyyat tələb olunur.

GenScript Real -time PCR (TaqMan) Astar Dizaynı - potensial PCR amplikonunun ölçü aralığını, primerlər və problar, eləcə də orqanizm üçün Tm (ərimə temperaturu) düzəldə bilərsiniz. Siz həmçinin alətin sizə qayıtmasını istədiyiniz neçə Primer/Prob dəstinə qərar verə bilərsiniz. Şablon olaraq bir GenBank giriş nömrəsindən istifadə etmək mümkündür.

QuantPrime - daha böyük qPCR təcrübələrində istifadə üçün etibarlı astar dizaynı üçün çevik bir proqramdır. Çevik çərçivə, qPCR üçün hidrolizasiya probu dizaynı və kəmiyyət üçün oligonükleotid zond dizaynı kimi digər kəmiyyət tətbiqlərində də sadə istifadə üçün açıqdır. yerində hibridləşmə. (İstinad: S. Arvidsson et al. 2008. BMC Bioinformatika 9:465)

PrimerQuest - (IDT, ABŞ)

Mutasiyaların tətbiqi:

WatCut (Michael Palmer, Waterloo Universiteti, Kanada) - bir oligonükleotid alır və zülalın amin turşusu ardıcıllığının dəyişməməsi üçün potensial məhdudlaşdırma yerlərində səssiz mutasiyalar tətbiq edir.

PrimerX - sahəyə yönəldilmiş mutagenez üçün mutagen primerlərin dizaynını avtomatlaşdırmaq üçün istifadə edilə bilər. İki növdə mövcuddur (a) DNT Sırasına əsaslanan Astar Dizaynı və (b) Protein Sırasına əsaslanan Astar Dizaynı

Primerize-2D - is designed to accelerate synthesis of large libraries of desired mutants through design and efficient organization of primers. The underlying program and graphical interface have been experimentally tested in our laboratory for RNA domains with lengths up to 300 nucleotides and libraries encompassing up to 960 variants. ( Reference: Tian, S., & Das, R. (2017) Bioinformatics 33(9): 1405-1406).

When you are ready to set-up your PCR reaction see:

PCR Box Titration Calculator (Allotron Biosensor Corporation) - for figuring out the amounts of each reagent to use in a two-dimensional box titration for PCR. For standard PCR reactions adjust volume, and change "row" and "column" number to "1", click on all the "top" or "bottom" and "done". PCR Titration Calculator (Angel Herráez Cybertory: virtual molecular biology lab Universidad de Alcalá, Spain) is a similar site.

PCR Reaction Mixture Setup (R. Kalendar, University of Helsinki, Finland) - very nice site (requires Java).

PCR Optimization (Bioline, United Kingdom) - a lot of conditions

Primer presentation on the DNA sequence:

Sequence Extractor (Paul Stothard) - generates a clickable restriction map and PCR primer map of a DNA sequence (accepted formats are: raw, GenBank, EMBL, and FASTA) offering a great deal of control on output. Protein translations and intron/exon boundaries are also shown. Use Sequence Extractor to build DNA constructs silisiumda.


Loop-Mediated Isothermal Amplification

Loop-mediated isothermal amplification (LAMP) uses 4-6 primers recognizing 6-8 distinct regions of target DNA for a highly specific amplification reaction. A strand-displacing DNA polymerase initiates synthesis and 2 specially designed primers form &ldquoloop&rdquo structures to facilitate subsequent rounds of amplification through extension on the loops and additional annealing of primers. DNA products are very long (>20 kb) and formed from numerous repeats of the short (80&ndash250 bp) target sequence, connected with single-stranded loop regions in long concatamers. These products are not typically appropriate for downstream manipulation, but target amplification is so extensive that numerous modes of detection are possible. Real-time fluorescence detection using intercalators or probes, lateral flow and agarose gel detection are all directly compatible with LAMP reactions. Instrumentation for LAMP typically requires consistent heating to the desired reaction temperature and, where needed, real-time fluorescence for quantitative measurements. Optimized settings for running LAMP experiments on isothermal instruments can be found here.

Reaction Temperature Amplicon Size Detection Method(s)
65°C <250 nt Visual, Lateral flow, Gel, Turbidity

Loop-mediated isothermal amplification (LAMP) uses 4-6 primers recognizing 6-8 distinct regions of target DNA. A strand-displacing DNA polymerase initiates synthesis and 2 of the primers form loop structures to facilitate subsequent rounds of amplification.

In addition to the more traditional or complex detection methods, LAMP is so prolific that the products and byproducts of these reactions can also be visualized by eye. For example, magnesium pyrophosphate produced during the reaction can be observed as a white precipitate or added indicators like calcein or hydroxynaphthol blue can be used to signal a positive reaction. Alternatively, using the 2X Colorimetric LAMP Master Mix developed by NEB enables a strong color change from pink to yellow based on a pH change during the reaction. An updated version of this product has been formulated with dUTP and UDG to be compatible with carryover prevention between amplification rounds &ndash WarmStart Colorimetric LAMP 2X Master Mix with UDG. The colorimetric detection technology is a key component of the SARS-CoV-2 Rapid Colorimetric LAMP Assay Kit, which can be used in the analysis of SARS-CoV-2, the novel coronavirus that causes COVID-19.

Designing LAMP primers can be challenging, but software tools greatly facilitate this process. We suggest using the NEB LAMP Primer Design Tool to design LAMP primers. After inputting a DNA or RNA sequence of interest, the LAMP Primer Design tool will identify suitable target regions and create the outer F3/B3 and looping inner FIP/BIP primers in a single step. The LoopF/LoopB primers, that accelerate the LAMP reaction, are created in a second step and are strongly recommended for best performance.

LAMP is well-suited for point-of-care and field diagnostics and LAMP assays have been designed for the detection of a wide range of RNA and DNA targets from all manner of sample types. Examples include tests for:

The LAMP reaction is robust and tolerant of inhibitors, allowing for crude sample prep and minimal nucleic acid purification if desired. WarmStart ® RTx and Bst 2.0 WarmStart were developed for optimal performance in LAMP/RT-LAMP and are combined in convenient LAMP Master Mixes to simplify assay design.


Videoya baxın: Part 1- Kronik Prostatit - Sebep u0026 Şikâyetler (Oktyabr 2022).