Məlumat

Çox allelləri faktiki genetik kod baxımından izah etməyə kömək edin

Çox allelləri faktiki genetik kod baxımından izah etməyə kömək edin


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Mən başa düşürəm ki, kiminsə alleldəki genetik quruluşu adətən (AA,Aa,aa) kimi işarələnir.

Bu o deməkdir ki, AT cütünün əvəzinə heç birində, 1 və ya 2 nüsxədə C-G cütü alırsınız.

Bir tri-alleliniz olduqda (qan qrupunda olduğu kimi) tam olaraq nə baş verir. Onlar iki əsas mövqeyə baxırlar? Yoxsa A -> C mutasiyası əvəzinə A->G mutasiyası kimi daha qəribə bir şey əldə edirsiniz (və buna görə də istiqaməti nəzərə almalısınız) və s?

Təşəkkürlər!


Bütün bunlar baş verir, lakin triallelik SNP-lər (tək nukleotid polimorfizmləri) genomdakı tək xüsusi bazanın üç əsasdan birinə malik ola biləcəyi vəziyyətə aiddir. məs.: A/G/C

Dəyişən ardıcıllıqla birdən çox bazanın olduğu hallar. Bunun həqiqətən bir adı yoxdur: (məsələn, AA -> GC).

Bunları a/b/c allel adlandırmaq olar.

Bunun adının olmamasının səbəbi yəqin ki, iki əsasın ümumi bir hadisə kimi eyni anda dəyişməməsidir. Əgər iki SNP bir-birinin yanındadırsa, onlar çox güman ki, müxtəlif vaxtlarda dəyişiblər, bu o deməkdir ki, kifayət qədər ətrafa baxsanız, AA, GC və GA tapa bilərsiniz, çünki A->G əvvəlcə, sonra isə bir neçə onlarla nəsil ikinci A- baş verdi. > C mutasiyası baş verdi.


Anlayıram ki, bir alleldəki birinin genetik quruluşu adətən (AA, Aa, aa) ilə ifadə olunur.

Xeyr. Bunu orta məktəbdə öyrənirsən, çünki bu, asandır və Mendel noxud bitkilərində öyrəndiyi 7 xüsusiyyət üçün işlədiyi şeydir. Əsl həyat a çox daha mürəkkəb. Əksər fenotipik fərqlər, biri klassik olaraq digərinə üstünlük verən tam olaraq iki allel ilə izah edilə bilməz.

Bu o deməkdir ki, AT cütünün əvəzinə heç birində, 1 və ya 2 nüsxədə C-G cütü alırsınız.

Mütləq deyil. İki allel öz ardıcıllığında bir çox nöqtədə fərqlənə bilər.

İnsanların DNT ardıcıllığını necə yazdıqları barədə bir az çaşqın görünürsən. DNT ikiqat sarmal olsa da, ardıcıllığın nə olduğunu danışdığımızda, bunun kimi yalnız bir ipdən bəhs edirik.

GAGCCATGGGGCGCCATGTTGCCACCAGCTGCCACGTGGCCTGGCTTTTGGTGCTGATCT

Bir mutasiya həmin sonuncu T-ni A-ya çevirə bilər, amma biz “heç nə olmayıb, bu hələ də A-T cütüdür” demirik, çünki hansı teldə hansı hərfin olması önəmlidir.

Bir tri-alleliniz olduqda (qan qrupunda olduğu kimi) tam olaraq nə baş verir.

Yaxşı, qan qrupu yalnız ABO -dan daha mürəkkəbdir ... amma burada bəzi faydalı detalları olan olduqca köhnə bir kağız var

http://www.ncbi.nlm.nih.gov/pubmed/2333095

"Burada biz ABO genotipləri üçün molekulyar əsas təqdim edirik. A və B genləri A və B transferaz spesifikliyində fərqlərə səbəb ola biləcək dörd amin turşusu qalığını dəyişən bir neçə tək əsaslı əvəzlənmədə fərqlənir. Kritik tək əsaslı delesiya olub. O genində tapılmışdır ki, bu da H antigenini dəyişdirə bilməyən tamamilə fərqli, qeyri-aktiv zülalla nəticələnir.


Bir allelin nə olduğunu həqiqətən də yaxşı başa düşdüyünüzə əmin deyiləm, ona görə də bir az küsməyə icazə verin və bunun kömək edib-etmədiyini görüm.

Qırmızı qan hüceyrəsinə "A" tipli karbohidrat yerləşdirən fermenti kodlayan gen, genin "IA" alleli adlanır. Bu gen təxminən 1065 əsas cüt uzunluğundadır. Bunu hərflə yazsaydınız, belə görünərdi:

CAATGGCCGGGTAATTAAAATTGACGAC…

GTTACCGGCCCATTAATTTTAACTGCTG… (1065 hərfə davam edin)

Ən çox rast gəlinən O allelinin, eyni baza cütləri seriyası vardır, yalnız bir baza cütü (G_C) 261 mövqeyində itirilir. Bu bir silmə mutasiyadır.

Ən çox yayılmış B alleli eyni gen ardıcıllığıdır, ancaq 297, 526, 657, 703, 796, 803 və 930 baza cütlərində kodlaşdırma ardıcıllığı daxilində yeddi tək əsaslı əvəzləmə var. Bunlar əvəzetmə mutasiyalarıdır.

Bunun mənası varmı? Əsas ABO qan növü geni hər alleldə demək olar ki, eynidir, lakin müxtəlif fenotiplərlə nəticələnən cüzi dəyişikliklərə malikdir. Və bu sadə versiyadır. İndi biz asanlıqla genləri ardıcıllıqla sıralaya bildiyimizə görə, bir çox insana baxa bilərik və görə bilərik ki, baza cütlərində kiçik dəyişikliklərlə hələ də "A" qanı ilə nəticələnən ən azı İRMİ müxtəlif gen ardıcıllığı var. Bu məqalədə nümunələri olan bir rəqəm görə bilərsiniz: http://www.ncbi.nlm.nih.gov/pubmed/12014997 (açıq mənbə)

Beləliklə, bir genin yüzlərlə əsas cütü olduğundan, bu gen üçün çox vaxt iki, üç və ya dörddən çox allel var. Baza cütləri əlavə edə, silə, dəyişdirə və digər xromosomlardan parçalara dəyişə bilərsiniz - hər cür şey olur.


Genetik kod

Redaktorlarımız göndərdiklərinizi nəzərdən keçirəcək və məqaləyə yenidən baxılıb -baxılmayacağını müəyyən edəcəklər.

Genetik kod, zülalların amin turşusu ardıcıllığını təyin edən deoksiribonuklein turşusunda (DNT) və ribonuklein turşusunda (RNT) nukleotidlərin ardıcıllığı. DNT -dəki nukleotidlərin xətti ardıcıllığı zülal ardıcıllığı üçün məlumatları ehtiva etsə də, zülallar birbaşa DNT -dən əmələ gəlmir. Bunun əvəzinə, DNT -dən bir xəbərçi RNT (mRNA) molekulu sintez olunur və zülalın əmələ gəlməsinə istiqamət verir. RNT dörd nukleotiddən ibarətdir: adenin (A), guanin (G), sitozin (C) və urasil (U). Üç bitişik nukleotid bir amin turşusunu kodlayan kodon kimi tanınan bir vahidi təşkil edir. Məsələn, AUG ardıcıllığı metionini amin turşusunu təyin edən kodondur. Üç mümkün amin turşularını kodlamayan, ancaq bir zülalın sonunu göstərən 64 mümkün kodon var. Qalan 61 kodon, zülalları təşkil edən 20 amin turşusunu təyin edir. AUG kodonu, metionini kodlamağa əlavə olaraq, hər mRNA -nın əvvəlində olur və bir zülalın başladığını göstərir. Metionin və triptofan yalnız bir kodon (müvafiq olaraq AUG və UGG) tərəfindən kodlanan yeganə iki amin turşusudur. Digər 18 amin turşusu iki -altı kodonla kodlanır. 20 amin turşusunun əksəriyyəti birdən çox kodon tərəfindən kodlandığı üçün kod degenerativ adlanır.

Bir zamanlar bütün həyat formalarında eyni olduğu düşünülən genetik kodun, müəyyən orqanizmlərdə və bəzi ökaryotların mitokondriyasında bir qədər fərqləndiyi aşkar edilmişdir. Buna baxmayaraq, bu fərqlər nadirdir və genetik kod demək olar ki, bütün növlərdə eynidir, eyni kodonlar eyni amin turşularını təyin edir. Genetik kodun deşifr edilməsi 1960 -cı illərin əvvəllərində Amerikalı biokimyacılar Marshall W. Nirenberg, Robert W. Holley və Har Gobind Khorana tərəfindən həyata keçirildi.

Müxtəlif amin turşularını təyin edən nukleotid üçlüləri (kodonlar) cədvəldə göstərilmişdir.


Tələbələr və Müəllimlər üçün

Yalnız Müəllimlər Üçün

DAVAMLI ANLAMA
EVO-2
Orqanizmlər ortaq nəsildən gələn mənşə xətləri ilə əlaqələndirilir.

IST-1
İrsi məlumatlar həyatın davamlılığını təmin edir.

ÖYRƏNMƏ MƏQSƏDİ
EVO-2.A
Paylaşılan, qorunan, əsas proseslərin və xüsusiyyətlərin bütün orqanizmlər üçün ortaq ata konsepsiyasını necə dəstəklədiyini izah edin.

IST-1.I
Mendel qanunları ilə izah edilən genlərin və xüsusiyyətlərin miras qalmasını izah edin.

ƏSAS BİLGİ
EVO-2.A.1
DNT və RNT genetik məlumat daşıyıcılarıdır.

EVO-2.A.2
Ribosomlar həyatın bütün formalarında olur.

EVO-2.A.3
Genetik kodun əsas xüsusiyyətləri bütün müasir canlı sistemlər tərəfindən paylaşılır.

EVO-2.A.4
Əsas metabolik yollar hazırda tanınan bütün domenlərdə qorunur.

İST-1.I.1
Mendelin seqreqasiya və müstəqil çeşidləmə qanunları müxtəlif xromosomlarda olan genlərə tətbiq edilə bilər.

İST-1.I.2
Mayalanma iki haploid gametin birləşməsini, xromosomların diploid sayını bərpa etməyi və ziqotda allellərin yeni birləşmələrini yaratmaqla populyasiyalarda genetik dəyişkənliyi artırmağı əhatə edir.

  1. Tək gen əlamətlərin valideyndən nəslə keçməsini təhlil etmək üçün ehtimal qaydaları tətbiq oluna bilər.
  2. Varislik nümunəsi (monohibrid, dihibrid, cinslə əlaqəli və genetik cəhətdən əlaqəli genlər) çox vaxt ana genotip/fenotip və nəslin genotip/fenotiplərini verən damazlıq da daxil olmaqla məlumatlardan proqnozlaşdırıla bilər.

MÜTLƏQ TƏDQİQATLAR

A və B bir -birini istisna edirsə, onda:

Əgər A və B müstəqildirsə, onda:


Gen və Allele arasındakı fərq nədir?

Gen irsi məlumat vahididir. Bəzi viruslar istisna olmaqla, genlər irsi əlamətlərin ötürülməsi üçün genetik məlumatı kodlayan kompleks molekul olan DNT-dən ibarətdir. Allellər də genetik ardıcıllıqlardır və onlar da xüsusiyyətlərin ötürülməsi üçün kod yazırlar. Beləliklə, bir genlə bir allel arasındakı fərq nədir?

Qısa cavab budur bir allel bir genin bir variant formasıdır. Daha ətraflı izah edildikdə, hər bir gen, hər bir valideyndən miras qalan bir nüsxə olmaqla, iki nüsxədə müəyyən bir lokusda (xromosomda yerləşmə) yaşayır. Ancaq nüsxələr eyni deyil. Bir genin nüsxələri bir-birindən fərqli olduqda, onlara allellər deyilir. Müəyyən bir gen çox fərqli allellərə malik ola bilər, baxmayaraq ki, hər hansı bir fərddə genin lokusunda yalnız iki allel mövcuddur.

Allellər bəzən fərqli fenotiplərlə (müşahidə edilə bilən xüsusiyyətlər) nəticələnə bilər, müəyyən allellər üstünlük təşkil edir (digər allellərin xüsusiyyətlərini üstələyir) və ya bəzi hallarda kodominant bir şəkildə hərəkət edən bir çox allel. Sonunculara misal olaraq insanın ABO qan qrupu sistemini göstərmək olar, burada AB qanı olan insanlarda A üçün bir allel və B üçün bir allel var (heç bir alleli olmayan insanlar O tiplidir). Dominant allel ifadəsinə misal noxud bitkilərində çiçək rəngidir. Bənövşəyi çiçəkləri olan bir bitki əslində dominant bir gendən ibarət bir genotipə (genetik quruluşa) malikdir. P və resessiv səh allel.


Genetik kodun xüsusiyyətləri

Üçqat təbiət

Üçlü kod 64 müxtəlif kombinasiya (4 X 4 X 4) üçün genetik kod yarada bilər və 20 amin turşusunun hamısının yerini müəyyən etmək üçün DNT molekulunda çoxlu məlumat verə bilər. Genetik kodu sındırmaq üçün eksperimentlər aparıldıqda bunun üçlü kod olduğu məlum oldu. Nukleotidlərin bu üç hərf koduna (AUG, AAA və s.) Kodon deyilir.

Degenerasiya

Kod dejenerativdir, yəni eyni amin turşusu birdən çox əsas üçlüyü ilə kodlanır. Məsələn, arginin, alanin və lösin adlı üç amin turşusunun hər biri altı sinonim kodona malikdir.

Üst -üstə düşməmək

Genetik kod üst-üstə düşmür, yəni bitişik kodonlar üst-üstə düşmür. Üst -üstə düşməyən kod eyni hərfin iki fərqli kodon üçün istifadə edilməməsi deməkdir. Başqa sözlə, birdən çox kodonun meydana gəlməsində tək bir baza iştirak edə bilməz.

Vergülsüz

Bir kodonun sonunu və digərinin başlanğıcını göstərən heç bir siqnal yoxdur. Genetik kod, virgülsüzdür (və ya virgülsüzdür).

Qeyri-müəyyənlik

Xüsusi bir kodon həmişə eyni amin turşusunu kodlaşdıracaq. Eyni amin turşusu birdən çox kodonla kodlana bildiyi halda (kod degenerativdir), eyni kodon iki və ya daha çox müxtəlif amin turşusu (qeyri-müəyyən) üçün kodlaşdırmamalıdır.

Universallıq

Kod Escherichia coli bakteriyası üzərində aparılan işlərə əsaslansa da, digər orqanizmlər üçün etibarlıdır. Genetik kodun bu vacib xüsusiyyətinə universallığı deyilir. Bu o deməkdir ki, 3 əsasdan ibarət olan eyni ardıcıllıqlar sadə mikroorqanizmlərdən tutmuş insan kimi kompleks, çoxhüceyrəli orqanizmlərə qədər bütün həyat formalarında eyni amin turşularını kodlaşdırır.

Polarite

Genetik kodun polaritesi var, yəni kod həmişə sabit bir istiqamətdə, yəni 5 ′ → 3 ′ istiqamətində oxunur.

Zəncirvari Başlama Kodonları

AUG və GUG üçəmləri ikili rol oynayır E. coli. Bir sistronun iki ucu arasında (ara mövqe) meydana gəldikdə, protein molekulunda ara bir mövqedə metionin və valinin amin turşularını kodlayırlar.

Zəncirin Son Kodonları

3 üçlü UAA, UAG, UGA heç bir amin turşusu üçün kod vermir. Qalan 61 kodondan fərqli olaraq, onlar ilkin olaraq qeyri-mənalı kodonlar kimi təsvir edilmişdir.


Allelik qarşılıqlı təsirlər

Mendel mirasının əməliyyatı Mendel tərəfindən qeydə alınan əlamətlərdən daha mürəkkəbdir. Birincisi, açıq-aydın dominantlıq və resessivlik heç vaxt həmişə tapılmır. Dörd saatlıq bitkilərin və ya snapdragonların qırmızı və ağ çiçəkli növləri kəsildikdə, məsələn, F1 hibridlərin orta çəhrayı və ya gül rəngli çiçəkləri var, bu vəziyyət Mendel anlayışlarından daha çox miras anlayışı ilə izah edilə bilər. Çiçək rənginin mirasının həqiqətən Mendel mexanizmlərindən qaynaqlandığı, F.1 hibridlərin keçməsinə icazə verilir, bu da F verir2 1 qırmızı : 2 çəhrayı : 1 ağ nisbətində qırmızı, çəhrayı və ağ çiçəkli bitkilərin nəsli. Aydındır ki, qırmızı və ağ çiçəklərin istehsalı üçün irsi məlumatlar birinci hibrid nəsildə qarışdırılmamışdır, çünki bu rəngli çiçəklər hibridlərin ikinci nəslində istehsal edilmişdir.

F -də görünən qarışıqlıq1 Nəsil, saat dördündə çiçək rəngini idarə edən gen allellərinin natamam bir üstünlük əlaqəsi göstərməsi ilə izah olunur. Tutaq ki, gen alleli R1 qırmızı çiçəklərdən məsuldur və R2 ağ üçün homozigotlar R1R1R2R2 sırasıyla qırmızı və ağ, heterozigotlardır R1R2 çəhrayı çiçəkləri var. Şorthorn mal-qarasında dominantlığın olmamasının oxşar nümunəsinə rast gəlinir. Fərqli orqanizmlərdə dominantlıq tamdan (homozigotlardan birindən fərqlənməyən heterozigotdan) natamam (heterozigotlardan tam aralıq) qədər həddindən artıq və ya həddindən artıq üstünlüyə (homozigotdan daha ifrat bir heterozigot) qədər dəyişir.

Başqa bir dominantlıq forması, heterozigotun hər iki allelin fenotipik xüsusiyyətlərini göstərməsidir. Buna kodominans deyilir, insanların MN qan qrupu sistemində bir nümunə görülür. MN qan qrupu iki allel tərəfindən idarə olunur, MN.. Üçün homozigot olan şəxslər M allellərin qırmızı qan hüceyrələrində bir səth molekulu (M antijeni deyilir) var. Eynilə, homozigot olanlar N. allel qırmızı qan hüceyrələrində N antigeninə malikdir. Heterozigotlar - hər iki alleli olanlar - hər iki antijeni daşıyırlar.


İrsiyyətdə DNT, Gen, Allel və Xromosomların Rolları

Valideynlərdən nəsillərə ötürülən məlumatların kodlaşdırılmış genlər vasitəsilə ötürüldüyünü izah edin DNT molekullar.

Əsas prosesi izah edin DNT replikasiya.

Transkripsiya və tərcümənin əsas proseslərini təsvir edin.

Çarpaz keçməyin, genlərin atlanmasının, genlərin silinməsinin və təkrarlanmasının genetik dəyişkənliyə necə səbəb olduğunu izah edin.

Necə olduğunu izah edin mutasiyalar genetik məlumatları və nəticədə meydana gələn hüceyrələrdəki mümkün nəticələrini dəyişdirə bilər.

Göstərmək üçün molekulyar modellərdən istifadə edin gen mutasiyasırekombinasiya molekulyar səviyyədə.

Prosesin necə getdiyini təsvir edin meioz haploid gametlərin meydana gəlməsi ilə nəticələnir və əhəmiyyətini təhlil edir meioz cinsi çoxalmada.

Funksiyasını müqayisə edin və ziddiyyət təşkil edin mitozmeyoz

Cinsi çoxalmada genlərin çeşidlənməsi və rekombinasiyası nəsillərdə çox müxtəlif mümkün gen birləşmələri ilə nəticələndiyini göstərin.

Əsas strukturunu təsvir edin DNT, o cümlədən hidrogen bağının rolu.

Prosesin necə olduğunu izah edin DNT replikasiya genetik kodun ötürülməsi və qorunması ilə nəticələnir.

Transkripsiya və tərcümənin gen ifadəsi ilə necə nəticələndiyini təsvir edin.

Replikasiya, transkripsiya və tərcümənin son məhsulları arasında fərqləndirin.

Genetik kodun universal olduğunu təsdiqləyən dəlillər gətirin.

Mendelin seqreqasiya və müstəqil çeşidləmə qanunlarının irsiyyət nümunələri vasitəsilə necə müşahidə oluna biləcəyini təsvir edin.

Bir neçə növ genetik əlamətlərin (dominant, resessiv, kodominant, cinslə əlaqəli, poligenik, natamam dominantlıq, çoxsaylı allellər) səbəb olduğu müşahidə edilən irsiyyət nümunələrini fərqləndirin.

Replikasiya, transkripsiya və tərcümə proseslərinin bütün orqanizmlərdə necə oxşar olduğunu izah edin. Gen hərəkətlərinin, irsiyyət nümunələrinin və hüceyrələrin və orqanizmlərin çoxalmasının həyatın davamlılığını necə izah etdiyini izah edin.

İrsi xüsusiyyətlərin molekulyar, hüceyrə və orqanizm səviyyəsində necə müşahidə oluna biləcəyini nümayiş etdirin.

Hüceyrə böyüməsi və çoxalması

Məqsədlər

Bu bölmədə, tələbələr vahid qiymətləndirməsinin sonuna hazırlaşmaq üçün genetik bölmənin bütün araşdırmasını tamamlayacaqlar. Tələbələr edəcək:

  • DNT replikasiyası, transkripsiyası və tərcüməsinin nəticələrini başa düşdüyünüzü ifadə edin.
  • zülalların istehsalında hər birinin rolunu təsvir edin: DNT, Gen, mRNA, tRNA, rRNA.
  • DNT-dəki nukleotid ardıcıllığının zülalların istehsalı ilə əlaqəsini müqayisə edin.

Əsas Suallar

Lüğət

  • Allellər: Eyni genin müxtəlif versiyalarını idarə etməkdən məsul olan gen formaları.
  • Amin turşusu: Bir amin qrupu ilə birləşmə (&ndashNH2) bir ucunda və bir ucunda karboksil qrupu (& ndashCOOH) polipeptidlər və zülallar üçün monomerdir.
  • Antikodonlar: Xüsusi bir amin turşusunu kodlayan tRNA üzərində üç nukleotid əsasının tamamlayıcı ardıcıllığı.
  • Əsas cütləşdirmə qaydası: DNT, RNT və ya hər ikisinin zəncirləri bir-biri ilə qoşalaşdıqda azotlu əsasların müşahidə edilən cütləşməsi. DNT-də: sitozin&ndaşquanin, adenin&ndaştimin isə RNT-də timin urasillə əvəz olunur.
  • Xromatin: DNT və zülallardan ibarət maddə.
  • Kodonlar: Xüsusi bir amin turşusunu kodlayan mRNT-də üç nukleotid əsasının ardıcıllığı.
  • Tamamlayıcı nukleotidlər: DNT, RNT və ya hər ikisinin zəncirləri bir-biri ilə qoşalaşdıqda bir-biri ilə cütləşən nukleotidlər.
  • DNT: Hüceyrələrin böyüməsi, bölünməsi və funksiyası üçün genetik məlumatları ehtiva edən iki zəncirli nuklein turşusu.
  • Dominant allel: Fərddə mövcud olduqda həmişə ifadə olunan allel.
  • Epistaz: İki və ya daha çox lokusda genlər arasında qarşılıqlı əlaqə, beləliklə, fenotip lokuslar müstəqil şəkildə ifadə edilsəydi gözləniləndən fərqlənir.
  • Gen: İrsiyyətin əsas, fiziki və funksional vahidi.
  • Genetika: Xüsusi əlamətlərin irsiyyət nümunələrinin öyrənilməsi.
  • Genotip: Bir orqanizmin genetik quruluşu.
  • Hemoglobin: Ağciyərlərdən bədən toxumalarına daşımaqdan məsul olan qırmızı qan hüceyrələrinin zülal əsaslı bir komponentidir.
  • İrsiyyət: Genetik faktorların valideyndən nəslə keçməsi.
  • Heterozigot: Eyni gen və ya əlaməti kodlayan fərqli allellərə sahib olmaq.
  • Homoziqot: Eyni xüsusiyyəti kodlayan iki eyni allelə sahib olmaq.
  • Natamam Dominantlıq: Heterozigotun homozigot dominant fenotipdən fərqli bir fenotip göstərdiyi xüsusiyyətlər.
  • Diqqət: Bir xromosomda bir genin və ya genlərin ardıcıllığının yeri cəm: lokuslar.
  • Messenger RNT (mRNA): Protein sintezi üçün təlimatları ehtiva edən tək telli RNT molekulu.
  • Mutasiya: DNT replikasiyasındakı bir səhv nəticəsində meydana gələn genetik materialdakı dəyişiklik. Mutasiyalar faydalı, zərərli və ya neytral ola bilər.
  • Azotlu əsaslar: DNT və RNT komponentləri olan azot tərkibli birləşmələr. DNT -də dörd azotlu əsas var: sitozin, guanin, adenin və timin (RNT -də urasil ilə əvəz olunur).
  • Nukleotid: DNT və RNT kimi nuklein turşularının əsas bina blokudur. Azotlu əsas, şəkər və fosfat qrupundan ibarət üzvi birləşmə.
  • Fenotip: Bir orqanizmin fiziki xüsusiyyətləri.
  • Poligenik: Bir neçə genin ümumi fenotipə töhfə verdiyi xüsusiyyətlər.
  • Polipeptid: Amin turşularından ibarət hər hansı bir üzvi makromolekul. Tərkibində karbon, hidrogen, oksigen və azot var.
  • Zülal: Xüsusi bir funksiyanı yerinə yetirən bir və ya daha çox polipeptiddən ibarət üzvi molekul.
  • Punnett Meydanı: Cütləşmənin mümkün nəslini göstərən ehtimal diaqramı.
  • Resessiv: Eyni geni və ya xüsusiyyəti kodlaşdıran bənzərsiz allellərə sahib olmaq.
  • Resessiv Allel: Yalnız bir xüsusiyyət üçün dominant allel olmadıqda ifadə olunan bir allel.
  • Replikasiya: Bir hüceyrənin DNT -ni kopyaladığı proses.
  • Ribosomal RNT (ribosom): Zülal və rRNT-dən ibarət sferik molekul zülal sintezi yeridir.
  • RNT polimeraz: Nüvədəki DNT ardıcıllığından RNT sintez edən RNT fermenti.
  • Oraq hüceyrəli anemiya: Qırmızı qan hüceyrələrinin bir hissəsinin anormal forma alması ilə əlaqəli otosomal resessiv genetik xəstəlik.
  • Xüsusiyyət: Bir fərddən digərinə dəyişən spesifik xüsusiyyət.
  • Transkripsiya: MRNA -nı DNT -dən pulsuz bir nukleotid ardıcıllığı ilə kodlayan proses.
  • Transfer RNT (tRNA): Zülal sintezi zamanı xüsusi bir amin turşusunu ribosoma və mRNA-ya köçürən RNT-nin tək telli molekulu.
  • Tərcümə: MRNA -dan təlimatları oxuyan və bir amin turşusu ardıcıllığı yaradan proses.
  • Üçqat: Xüsusi bir amin turşusunu kodlayan DNT-də üç nukleotid əsasının ardıcıllığı.

Müddət

İlkin Bacarıqlar

Materiallar

  • Müəllim Hazırlıq Materialları & ndashGendən Zülala (S-B-5-3_Müəllim Hazırlıq Sənədi.pdf)
  • Gendən Proteinə və ndashTələbə Təlimatı (S-B-5-3_Gendən Protein Tələbə Təlimatına qədər.doc)
  • Gendən Proteinə və ndashTələbə Sualları (S-B-5-3_Gendən Protein Tələbə Suallarına.doc)
  • Gendən Proteinə Cavab Açarı (S-B-5-3_Gendən Proteinə KEY.doc)
  • Modelləşdirmə Prosedur Materialları (S-B-5-3_Modelləşdirmə Prosedur Materialları-Gendən Proteinə.pdf)
  • Slip Şablonundan və ndashDays 1 və 2-dən çıxın (S-B-5-3_Slip-Days 1 və 2 Template.doc)
  • Slip Şablonundan & ndashDays 3 və 4-dən çıxın (S-B-5-3_Slip-Days 3 və 4 Template.doc)
  • Genetik Miras Mahnısı/Rep Rubrikası (S-B-5-3_Genetic Heritance Mahnısı və ya Rep Rubrikası.docx)
  • afişa və ya diaqram kağızı, hər qrup üçün bir ədəd
  • rəngli surət kağızı (x3 rəng)
  • şəffaf lent
  • marker, hər qrup üçün bir
  • 1 və 2-ci dərslərdən tələbələrin qeydləri

Əlaqədar Bölmə və Dərs Planları

Əlaqədar Materiallar və Resurslar

Aşağıdakı kommersiya veb-saytlarının mümkün daxil edilməsi onların pulsuz olmayan və bu dərs planı üçün tələb olunmayan məhsullarının nəzərdə tutulan təsdiqi deyil.

  • Müəllim Hazırlığı Materialları&ndashGendən Proteinə (S-B-5-3_Müəllim Hazırlığı Sənədi.pdf)
  • Gendən Proteinə&ndashTələbə Təqdimatı (S-B-5-3_Gendən Zülal Tələbə Təqdimatı.doc)
  • Gendən Proteinə və ndashTələbə Sualları (S-B-5-3_Gendən Protein Tələbə Suallarına.doc)
  • Gendən Protein Cavab Açarına (S-B-5-3_Gendən Proteinə KEY.doc)
  • Modelləşdirmə Prosedur Materialları (S-B-5-3_Modelləşdirmə Prosedur Materialları-Gendən Protein.pdf-ə qədər)
  • Slip Şablonundan və ndashDays 1 və 2-dən çıxın (S-B-5-3_Slip-Days 1 və 2 Template.doc)
  • Çıxış Slip Şablonundan&ndash3 və 4-cü Günlər (S-B-5-3_Çıxış Slip-Gün 3 və 4 Template.doc)
  • Genetik Varislik Mahnısı/Rap Rubrikası (S-B-5-3_Genetik Miras Mahnısı və ya Rap Rubri.docx)
  • afişa və ya diaqram kağızı, hər qrup üçün bir ədəd
  • rəngli surət kağızı (x3 rəng)
  • şəffaf lent
  • marker, hər qrup üçün bir
  • tələbələr və 1 və 2 -ci dərslərdən rsquo qeydləri

Formativ Qiymətləndirmə

  • Tərcümə və transkripsiyanı ümumi başa düşmək üçün qrup işi zamanı tələbə cavablarını qiymətləndirin.
  • Fərdi qiymətləndirmə üçün Tələbə Suallarını toplayın.
  • Hər dərsin sonunda çıxış fişləri/bilet vasitəsilə şagirdin özünü qiymətləndirməsini daxil edin.

Təklif olunan Tədris Dəstəkləri

Scaffolding, Active Engagement, Modeling, Explicit Instruction
W: Bu dərsdə şagirdlər mahnı və ya rep yazarkən genetik miras haqqında öyrəndiklərini sintez edirlər.
H: Dərs 1 və 2-ci Dərslərin məzmununun nəzərdən keçirilməsi ilə açılır. Mümkünsə, tələbələrin diqqətini cəlb etmək üçün Əlaqədar Resurslar bölməsindəki genetik replərdən birini oynayın.
E: Mahnı/rep yazmaqla tələbələr yekun vahid qiymətləndirmələrinə hazırlaşırlar.
R: Şagirdlər beyin həmləsi zamanı və mahnı/rep yazarkən 1-ci və 2-ci Dərslərin məzmununa yenidən baxırlar.
E: Şagirdlər mahnı/rep yazarkən özlərini qiymətləndirmək üçün rubrikadan istifadə edə bilərlər. Anladıqlarını yazılı şəkildə və istəyə bağlı olaraq işlərini sinfə təqdim etməklə ifadə edirlər.
T: Bu dərs, şagirdlər işə başlamazdan əvvəl digər genetik mahnı və rap nümunələrini təqdim etməklə uyğunlaşdırıla bilər. Şagirdlər də fəaliyyət üçün qarışıq qabiliyyətli qruplara yerləşdirilə bilər.
O: Dərs, şagirdlərin transkripsiya və tərcümə proseslərinin kağız modelini hazırladıqları və sonrakı sualları cavablandırdıqları bir fəaliyyət həyata keçirməzdən əvvəl nəzərdən keçirmə sualları və beyin fırtınası sessiyası ilə başlayır.

Təlimat Prosedurları

Hazırlanması:

  • Müəllim üçün Hazırlıq Materialları&ndashGendən Proteinə (S-B-5-3_Müəllim Hazırlığı Sənədi.pdf) səhifələrində ikinci-dördüncü səhifələrdə Ümumi Biologiya və Müzakirə üçün Təkliflər bölməsini oxuyun. Bu əsas bilik tələbələrə tələbə suallarını və modelləşdirmə fəaliyyətlərini tamamlamaqda kömək edəcək.
  • Tələbələr üçün Modelləşdirmə Prosedur Materialları paketini yaradın (S-B-5-3_Modelləşdirmə Prosedur Materialları-Gendən Proteinə.pdf). Hər bir tələbə aşağıdakı materiallara ehtiyac duyacaq:

o DNT molekulu (&ldquoHemoqlobin Geninin başlanğıcı&rdquo) rəngli kağız üzərində (şablonu üfüqi zolaqlara kəsin)

mRNA & rdquo şeridinin ikinci hissəsi və ayrı -ayrı rəngli kağız üzərində kəsilmiş 9 RNT nukleotidi. (Hər bir paketdə 1A, 2C, 3G və 3U olmalıdır.)

o RNT nukleotidləri ilə eyni rəngli kağız üzərində 6 tRNA molekulu (hər bir tRNA düzbucağını kəsin və hər paketdə altı növ tRNA -dan biri olan ldquoAmino Acid və rdquo sözlərinin altına üç nukleotid daxil edin)

o fərqli rəngli kağızdakı 6 amin turşusunun adı (paket başına hər bir amin turşusundan biri: lösin, histidin, valin, treonin, prolin,glutamik turşusu)

De ki, & ldquoBu dərsdə son iki dərsdə öyrəndiklərimizi bir araya gətirəcəyik. Bu bölməni Gregor Mendelin işinə və noxud bitkiləri ilə etdiyi təcrübələrə baxaraq başladıq. Buradan mirasın bəzi əsas prinsiplərini öyrəndik. & Rdquo

&ldquoHər kəs Mendelin işini və onun mirasla necə əlaqəli olduğunu ümumiləşdirə bilərmi?&rdquo (Şagirdlərə cavab vermək üçün vaxt verin.)

&ldquoMendelin işindən biz DNT replikasiyasına daha yaxından nəzər salmağa davam etdik. DNT replikasiyasının genetik mirasla nə əlaqəsi var? & Rdquo (Şagirdlərə cavab vermək üçün vaxt verin.)

Şagirdlər materiallarını toplayarkən, aşağıdakı sualları lövhəyə yazın və şagirdlərə bir müddət başqa bir şagirdlə məsləhətləşərək cavabları tapsın.

2. Zülal hazırlamaq üçün göstərişlər _____ molekulunun xüsusi seqmenti olan gen tərəfindən təmin edilir.

Davam etməzdən əvvəl cavabları nəzərdən keçirin və tələbələrin suallarını cavablandırın.

1. Zülal bir-birinə bağlı uzun amin turşuları qatarıdır. Proteinlər quruluş (bağlar, dırnaqlar, saçlar), həzmə köməklik (mədə fermentləri), hərəkətə köməklik (əzələlər) və görmə qabiliyyətimizdə rol oynaya biləcək fərqli funksiyalara malikdirlər (gözümüzün lensi saf kristal zülaldır) ).

Şagirdləri şagird paylama kitabındakı 1 və ndash2 səhifələrini oxumağa və ortaqları ilə birlikdə 1 və ndash7 suallarını cavablandırmağa yönəldin.

Bitirdikdən sonra tələbələrə izah edin ki, onlar transkripsiya və tərcümə haqqında daha çox öyrənmək üçün kağız modellərindən istifadə edəcəklər. Hüceyrənin hemoglobin molekulunun başlanğıcını yaratmaq üçün transkripsiya və tərcüməni necə həyata keçirdiyini modelləşdirəcəklər. Hemoqlobinin qırmızı qan hüceyrələrinin zülal əsaslı komponenti olduğunu və ilk növbədə ağciyərlərdən bədənin toxumalarına daşınmasından məsul olduğunu izah edin. Hər bir cüt tələbəyə aşağıdakıları paylayın:

  • Bu dərsin Hazırlıq bölməsində təsvir edildiyi kimi Modelləşdirmə Proseduru Materialları Paketi (bax: S-B-5-3_Modelləşdirmə Proseduru Materialları-Resurslar qovluğunda Gendən Proteinə qədər)
  • tape
  • qayçı

İkinci Dərsdə nəzərdən keçirilən əsas cütləşmə anlayışını nəzərdən keçirin.

Oxşar əsas cütləşmə prosesinin transkripsiyada baş verdiyini, lakin transkripsiyada DNT-də tapılan A&ndashT cütləşməsinin əvəzinə, əsas adeninin RNT-də olan urasil ilə cütləşdiyini izah edin.

Tələbələrə transkripsiya prosesində onlara aşağıdakı kimi rəhbərlik edəcəyinizi öyrədin: Şagirdlər, transkripsiyanı həyata keçirmək üçün hüceyrənin istifadə etdiyi addımların həqiqi ardıcıllığını modelləşdirmək üçün tərəfdaşlarla işləyəcəklər. Şagirdlərə deyin ki, mRNA-nı düzəltməyin daha sürətli bir yolunu düşünə bilsələr də, hüceyrənin mRNA-nı əslində necə meydana gətirdiyini öyrənmək üçün əl kitablarında təsvir olunan addımlar ardıcıllığını izləməlidirlər.

Hər bir cüt şagirdə səhifə 3 -də verilmiş yazılardan Transkripsiya Modelləşdirmə Prosedurunu yerinə yetirmələrini tapşırın. Transkripsiya Modelləşdirmə Prosedurlarını başa vurduqdan sonra, tələbələrin suallar sənədindəki cavablarını nəzərdən keçirməsini istəyin. Tələbə cavablarının hərtərəfli və dəqiq olması üçün nəzərdən keçirilməsi hansı şagirdlərin konsepsiyanı yaxşı başa düşdüyünü və hansı şagirdlərin əlavə dəstəyə ehtiyacı ola biləcəyini göstərə bilər.

Yardıma ehtiyacı olan köməkçi qrupları sinifdə gəzdirin.

Bir genin mRNA molekulunun sintezini necə idarə etdiyini izah edərək şagirdlərə öyrəndiklərini ümumiləşdirməyi tapşırın. Çıxış sənədində cavab verəcəklər (S-B-5-3_Exit Slip-Days 1 və 2 Template.doc). Şagirdlərə genin mRNT molekulunun sintezini necə idarə etdiyini izah edərək öyrəndiklərini ümumiləşdirməyi tapşırın. Tələbələrə izahatlarına söz və ifadələri daxil etmələrini deyin: baza cütləşdirmə qaydası, tamamlayıcı nukleotidlər, və sitoplazma.

Tələbələrə sonuncu dərsin sonunda verilən çıxış slipi sualına cavabları paylaşmağa icazə verməklə başlayın. Birlikdə tələbələr ən yaxşı cavabları paylaşacaq və suala ən uyğun cavabları seçəcəklər.

Tələbələrə növbəti tərcümə prosesini modelləşdirəcəklərini bildirin. Tələbələrdən tərcümədə əvvəllər əhatə olunmuş məzmunu nəzərdən keçirin. Tərcümə ilə bağlı anlayışları aydınlaşdırmağa başlayın. Tələbə könüllülərindən məzmunu nəzərdən keçirmələrini və anlayışların aydınlaşdırılması üçün sinif müzakirəsinə başlamalarını xahiş edin. Tələbələrin irəli getməyə hazır olduqlarını müəyyən etdikdə, onlar öz paylama materiallarının 5-ci və ndash7-ci səhifələrində Tərcümə Modelləşdirmə Proseduruna başlaya bilərlər.

  • Tələbələrin 1-ci gündən qruplara qayıtmasını təmin edin.
  • Şagirdlərə şagird paylama kitabının 3 və ndash4 səhifələrini oxumağı öyrət və sonra Tərcümə Modelləşdirmə Proseduruna əməl et.
  • Proseduru yerinə yetirərkən tələbə qruplarını aktiv şəkildə izləyin, lazım olduqda sualları cavablandırın.

Sinfi bir yerə toplayın və tələbələri sual sənədlərində qalan bütün suallar üzərində işləməyə yönəldin.

Şagirdlər sualları cavablandırdıqdan sonra, ayrılmadan əvvəl tamamlamaq və təhvil vermək üçün onlara çıxış bileti verilə bilər (S-B-5-3_Exit Slip-Days 3 və 4 Template.doc).

Şagirdlərə genin zülalın sintezini necə idarə etdiyini izah edərək öyrəndiklərini ümumiləşdirməyi tapşırın. Şagirdlər izahatlarına sözləri daxil etməlidirlər amin turşusu, anti-kodonlar, kodonlar, sitoplazma, DNT, mRNT, nukleotid, nüvə, ribosom, RNT polimeraza, tRNT, transkripsiya, və tərcümə.

Şagirdləri kiçik qruplara yerləşdirin və hər qrupa poster və ya diaqram kağızı və marker verin. Tələbələrdən hər bir qrup 1 və 2-ci dərslərdəki lüğət və anlayışlar haqqında beyin fırtınası aparsın və onları posterdə qeyd etsin. Onlar sözlər, ifadələr, cümlələr yaza və/yaxud afişaya diaqram və ya şəkillər daxil edə bilərlər.

Şagirdlərə deyin, &ldquoSiz genetik irsiyyətlə bağlı mahnı və ya rep yazacaqsınız. Sizə kömək etmək üçün afişanızdakı fikirlərdən və qeydlərinizdən istifadə edə bilərsiniz. Mahnınız/rapiniz irsiyyətdə DNT, allellər, genlər və xromosomların rollarını aydın şəkildə izah etməlidir. Buraya Mendelin işi və həmçinin DNT replikasiyası haqqında məlumat daxil edilməlidir.&rdquo

Genetik Miras Mahnısının/Rap Rubrikinin surətini yaradın və tələbələrə verin və onlarla birlikdə oxuyun (S-B-5-3_Genetic Heritance Song və ya Rap Rubric.docx). Başlamazdan əvvəl şagirdlərin bütün suallarını cavablandırın.

Şagirdlərdən mahnı və ya rep yazmaq üçün tək və ya qruplar şəklində işləməsini istəyin. Vaxt imkan verərsə, bir neçə şagirdin mahnılarını sinifə təqdim etsin.


"Universal genetik kod" ifadəsi nə deməkdir? Explain what this means using two unique living things and what they have in common.

"1. it should be, it has been for about 20 years, and it's really not much different in the end than breeding animals to have particular traits. there are always concerns about genetically engineered animals/plants affecting the environment in unexpected negative ways, but i can't think of an example where the fears didn't turn out to be baseless.

first, as you point out, it would be a great advance in pharmacology, to be able to tailor drugs and their doses to me. the pros involve better medical treatment. the cons involve privacy issues like insurance companies denying coverage to people with genetic risk factors. looking at dna markers wouldn't affect the frequency of genetic diseases, but it would allow detection of them earlier. and ok, actually i suppose that if people used this information to avoid having children with genetic diseases, some might decrease in frequency."


IB Biology/Genetics

Sex linkage is the association of a characteristic with gender, because the gene controlling the characteristic is located on a sex chromosome.

State two examples of sex-linkage

Color blindness and hemophilia- both these conditions are produced by a recessive sex-linked allele on the X chromosome.

State that a human female can be homozygous or heterozygous with respect to to sex-linkage genes.

Explain that female carriers are heterozygous for X-linked recessive alleles

Calculate and predict the genotypic and phenotypic ratio of offspring of monohybrid crosses involving any of the above patterns of inheritance

Deduce the genotypes or phenotypes of individuals in pedigree charts

3.4 Genetic Engineering and Other Aspects of Biotechnology Edit

State that PCR (Polymerase Chain Reaction) copies and amplifies minute quantities of nucleic acid.

State that gel electrophoresis involves the separation of fragmented pieces of DNA according to their charge and size.

  • Based on idea that molecules move at different rates (and directions) when placed in an electric field due to different charges and sizes.

State that gel electrophoresis of DNA is used in DNA profiling.

Describe two applications of DNA profiling.

  • Paternity suits (determining parent-child relationships).
  • Criminal investigations (using blood or semen collected from the scene).
  • Identification of people long dead (e.g. Egyptian mummies, Russian Tsars).
  • Everyone's DNA is unique and so can be used in identification however, samples can be contaminated.

Define genetic screening.

Discuss three advantages and/or disadvantages of genetic screening.

  • Advantages include: Checking unborn babies for genetic disorders, can gain knowledge about one's own genotype.
  • Disadvantages include: Ethical issues (e.g. selection, abortion(?))

State that the Human Genome Project is an international cooperative venture established to sequence the complete human genome.

  • The human genome has 30,000 to 40,000 genes. The HGP is attempting to find the location of all these genes and their base sequence.

Describe two advantageous outcomes of this project

  • Easier to study how genes control human development.
  • Allow identification of genetic diseases and allow for the production of a drug based on the normal DNA sequences of genes.

State that genetic material can be transferred between species because the genetic code is universal

  • The genetic code is universal. This means that genes can be transfered from one organism to another, (and this has indeed been the case). Organisms that have had genes transferred to them are called genetically modified organisms.

Outline the basic technique for gene transfer involving plasmids, a host cell (bacterium, yeast or other cell) restriction enzymes (endonucleases) and DNA ligase.

  1. Messenger RNA coded for insulin is extracted from human pancreas cells.
  2. DNA copies of the messenger RNA coding for insulin are made using the enzyme reverse transcriptase.
  1. Plasmids: are small loops of DNA found in bacteria.
  2. Plasmids are cut open using restriction enzyme endonucleouse.
  3. The insulin gene and the plasmid are mixed.
  1. DNA ligase seals up the plasmid.
  2. The plasmid with the human insulin gene is inserted into a recombinant plasmid.
  3. The recombinant plasmid are mixed with a strain of E.Coli bacteria.
  4. The E.coli bacteria start to make insulin which is then extracted, purified and used by patients suffering from diabities.

State two examples of the current uses of genetically modified crops or animals

  • Golden rice is a genetically modified rice crop that produces beta-carotene, which can be metabolized into Vitamin A within the body. Scientists hope that golden rice will eventually be a cheap source of beta-carotene in malnourished countries, reducing the number of children worldwide that go blind from Vitamin A deficiency.
  • Bt maize is a genetically modified corn crop that produces a toxin that kills European corn borers feeding on the maize.

Discuss the potential benefits and potential harmful effects of one example of genetic modificiation

  • Bt Maize: Contains a gene which releases toxin that kills insects feeding on the maize.
  • Üstünlüklər: Less pest damage, and therefore better harvests.
  • Dezavantajlar: Humans or animals that eat BT Maize might be harmed by bacterial DNA in it.

Outline the process of gene therapy using a named example

  • Gene Therapy: is the treatment of a genetic disease by altering the genotype. It is is still very experimental. However, if the allele of a gene is recessive, then perhaps the dominant gene could be inserted to prevent that disease. SCID (Severe combined immune deficiency) is caused by lack of the enzyme ADA. It produces lymphocytes, without it, the body cannot fight diseases. The gene causing SCID is recessive.
  1. Genetic screening shows a baby has SCID.
  2. The gene that codes for ADA is obtained. The gene is inserted into a retrovirus.
  3. The retrovirus is mixed with stem cells. They enter and insert the gene into the stem cell's chromosomes.
  4. Stem cells containing ADA are injected back into the baby's blood stream.

"SCID-ADA-l(ymphcytes)" / "skedaddle"

  • A clone is a group of genetically identical organisms or a group of genetically identical cells derived from a single parent.

Outline the technique for cloning using differentiated cells

    Udder cells are taken from a donor sheep. The genes in the cell are made dormant.


Məzmun

Genetic diversity is the variability of genes in a species. A number of means can express the level of genetic diversity: observed heterozygosity, expected heterozygosity, the mean number of alleles per locus, or the percentage of polymorphic loci.

Genetic diversity determines the potential fitness of a population and ultimately its long-term persistence, because genes encode phenotypic information. Extinction risk has been associated with low genetic diversity and several researchers have documented reduced fitness in populations with low genetic diversity. For example, low heterozigosity has been associated with low juvenile survival, reduced population growth, low body size, and diminished adult lifespan. [1] [2] [5] [6] [7]

Heterozygosity, a fundamental measurement of genetic diversity in population genetics, plays an important role in determining the chance of a population surviving environmental change, novel pathogens not previously encountered, as well as the average fitness of a population over successive generations. Heterozygosity is also deeply connected, in population genetics theory, to population size (which itself clearly has a fundamental importance to conservation). All things being equal, small populations will be less heterozygous – across their whole genomes – than comparable, but larger, populations. This lower heterozygosity (i.e. low genetic diversity) renders small populations more susceptible to the challenges mentioned above.

In a small population, over successive generations and without gene flow, the probability of mating with close relatives becomes very high, leading to inbreeding depression – a reduction in fitness of the population. The reduced fitness of the offspring of closely related individuals is fundamentally tied to the concept of heterozygosity, as the offspring of these kinds of pairings are, by necessity, less heterozygous (more homozygous) across their whole genomes than outbred individuals. A diploid individual with the same maternal and paternal grandfather, for example, will have a much higher chance of being homozygous at any loci inherited from the paternal copies of each of their parents' genomes than would an individual with unrelated maternal and paternal grandfathers (each diploid individual inherits one copy of their genome from their mother and one from their father).

High homozygosity (low heterozygosity) reduces fitness because it exposes the phenotypic effects of recessive alleles at homozygous sites. Selection can favour the maintenance of alleles which reduce the fitness of homozygotes, the textbook example being the sickle-cell beta-globin allele, which is maintained at high frequencies in populations where malaria is endemic due to the highly adaptive heterozygous phenotype (resistance to the malarial parasite Plasmodium falciparum).

Low genetic diversity also reduces the opportunities for chromosomal crossover during meiosis to create new combinations of alleles on chromosomes, effectively increasing the average length of unrecombined tracts of chromosomes inherited from parents. This in turn reduces the efficacy of selection, across successive generations, to remove fitness-reducing alleles and promote fitness-enhancing allelels from a population. (A simple hypothetical example would be two adjacent genes – A and B – on the same chromosome in an individual. If the allele at A promotes fitness "one point", while the allele at B reduces fitness "one point", but the two genes are inherited together, then selection cannot favour the allele at A while penalising the allele at B – the fitness balance is "zero points". Recombination can swap out alternative alleles at A and B, allowing selection to promote the optimal alleles to the optimal frequencies in the population – but only if there are alternative alleles to choose between!)

The fundamental connection between genetic diversity and population size in population genetics theory can be clearly seen in the classic population genetics measure of genetic diversity, the Watterson estimator, in which genetic diversity is measured as a function of effective population size and mutation rate. Given the relationship between population size, mutation rate, and genetic diversity, it is clearly important to recognise populations at risk of losing genetic diversity before problems arise as a result of the loss of that genetic diversity. Once lost, genetic diversity can only be restored by mutation and gene flow. If a species is already on the brink of extinction there will likely be no populations to use to restore diversity by gene flow, and any given population will (by definition) be small and therefore diversity will accumulate in that population by mutation much more slowly than it would in a comparable, but bigger, population (since there are fewer individuals whose genomes are mutating in a smaller population than a bigger population).

    and inbreeding depression. [8][9]
  1. The accumulation of deleterious mutations[10]
  2. A decrease in frequency of heterozygotes in a population, or heterozygosity, which decreases a species' ability to evolve to deal with change in the environment [11][12][13] uncertainties, which can lead to a reprioritization of conservation efforts [14] as the main evolutionary process, instead of natural selection
  3. Management units within species
  4. Hybridization with allochthonous species, with the progressive substitution of the initial endemic species.

Specific genetic techniques are used to assess the genomes of a species regarding specific conservation issues as well as general population structure. [15] This analysis can be done in two ways, with current DNA of individuals or historic DNA. [16]

Techniques for analysing the differences between individuals and populations include

These different techniques focus on different variable areas of the genomes within animals and plants. The specific information that is required determines which techniques are used and which parts of the genome are analysed. For example, mitochondrial DNA in animals has a high substitution rate, which makes it useful for identifying differences between individuals. However, it is only inherited in the female line, and the mitochondrial genome is relatively small. In plants, the mitochondrial DNA has very high rates of structural mutations, so is rarely used for genetic markers, as the chloroplast genome can be used instead. Other sites in the genome that are subject to high mutation rates such as the major histocompatibility complex, and the microsatellites and minisatellites are also frequently used.

These techniques can provide information on long-term conservation of genetic diversity and expound demographic and ecological matters such as taxonomy. [15]

Another technique is using historic DNA for genetic analysis. Historic DNA is important because it allows geneticists to understand how species reacted to changes to conditions in the past. This is a key to understanding the reactions of similar species in the future. [16]

Techniques using historic DNA include looking at preserved remains found in museums and caves. [17] Museums are used because there is a wide range of species that are available to scientists all over the world. The problem with museums is that, historical perspectives are important because understanding how species reacted to changes in conditions in the past is a key to understanding reactions of similar species in the future. [17] Evidence found in caves provides a longer perspective and does not disturb the animals. [17]

Another technique that relies on specific genetics of an individual is noninvasive monitoring, which uses extracted DNA from organic material that an individual leaves behind, such as a feather. [17] This too avoids disrupting the animals and can provide information about the sex, movement, kinship and diet of an individual. [17]

Other more general techniques can be used to correct genetic factors that lead to extinction and risk of extinction. For example, when minimizing inbreeding and increasing genetic variation multiple steps can be taken. Increasing heterozygosity through immigration, increasing the generational interval through cryopreservation or breeding from older animals, and increasing the effective population size through equalization of family size all helps minimize inbreeding and its effects. [18] Deleterious alleles arise through mutation, however certain recessive ones can become more prevalent due to inbreeding. [18] Deleterious mutations that arise from inbreeding can be removed by purging, or natural selection. [18] Populations raised in captivity with the intent of being reintroduced in the wild suffer from adaptations to captivity. [19]

Inbreeding depression, loss of genetic diversity, and genetic adaptation to captivity are disadvantageous in the wild, and many of these issues can be dealt with through the aforementioned techniques aimed at increasing heterozygosity. In addition creating a captive environment that closely resembles the wild and fragmenting the populations so there is less response to selection also help reduce adaptation to captivity. [20]

Solutions to minimize the factors that lead to extinction and risk of extinction often overlap because the factors themselves overlap. For example, deleterious mutations are added to populations through mutation, however the deleterious mutations conservation biologists are concerned with are ones that are brought about by inbreeding, because those are the ones that can be taken care of by reducing inbreeding. Here the techniques to reduce inbreeding also help decrease the accumulation of deleterious mutations.

These techniques have wide-ranging applications. One application of these specific molecular techniques is in defining species and sub-species of salmonids. [15] Hybridization is an especially important issue in salmonids and this has wide-ranging conservation, political, social and economic implications. In Cutthroat Trout mtDNA and alloenzyme analysis, hybridization between native and non-native species was shown to be one of the major factors contributing to the decline in their populations. This led to efforts to remove some hybridized populations so native populations could breed more readily. Cases like these impact everything from the economy of local fishermen to larger companies, such as timber. Specific molecular techniques led to a closer analysis of taxonomic relationships, which is one factor that can lead to extinctions if unclear.

New technology in conservation genetics has many implications for the future of conservation biology. At the molecular level, new technologies are advancing. Some of these techniques include the analysis of minisatellites and MHC. [15] These molecular techniques have wider effects from clarifying taxonomic relationships, as in the previous example, to determining the best individuals to reintroduce to a population for recovery by determining kinship. These effects then have consequences that reach even further. Conservation of species has implications for humans in the economic, social, and political realms. [15] In the biological realm increased genotypic diversity has been shown to help ecosystem recovery, as seen in a community of grasses which was able to resist disturbance to grazing geese through greater genotypic diversity. [21] Because species diversity increases ecosystem function, increasing biodiversity through new conservation genetic techniques has wider reaching effects than before.


Videoya baxın: HAMİLƏLİK ZAMANI DAUN SİNDROMU (Dekabr 2022).