Məlumat

Çox uzun PCR məhsulları üçün dNTP-lərin miqdarı məhdudlaşdırılırmı?

Çox uzun PCR məhsulları üçün dNTP-lərin miqdarı məhdudlaşdırılırmı?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Mən Q5 sistemindən istifadə edirəm və son uzunluğu təxminən 9500 bazaya malik olacaq bir məhsulu PCR edirəm. Məhsulun orada olduğunu, lakin çox zəif olduğunu gördüm. Görünür, primer tükənib.

Sualım budur ki, dNTP-lər uzun bir reaksiyada sürəti məhdudlaşdıra bilərmi? Yəni, bütün dNTP-lər ilk PCR dövrlərində istifadə oluna bilər və bəlkə də sonrakı eksponensial dövrlər üçün mövcud olmaya bilər?

Deyəsən, sizdə primerin miqdarından təxminən 1000 dəfə çox dNTP var (0,2 µM ilə müqayisədə 200 µM). Deməli, bəlkə də… və ya əsas kimyam bitib. Hər hansı bir üstünlük?


50ul reaksiya qarışığında 200uM dNTP-lər PCR məhsullarının uzunluğundan asılı olmayaraq bütün dNTP-lər istehlak edilərsə, 10ug DNT-dən çox istehsal edə bilər. EtBr istifadə edərək adi elektroforezlə 5ng qədər aşağı DNT fraqmentlərini aşkar edə bilərsiniz. 100 ng-dən çox DNT fraqmentini yüklədiyiniz zaman yəqin ki, aydın zolaq görə bilərsiniz. Buna görə də dNTP konsentrasiyası məni çox narahat etmir.

Nə qədər uzun PCR məhsulları gücləndirirsinizsə, gücləndirmək bir o qədər çətindir. O zaman siz PCR məhsullarınızı aşkar etmək üçün kifayət qədər səmərəliliyi əldə edə bilməyəcəksiniz. DMSO, betain və s. kimi bəzi əlavələri olan/olmayan heç bir qeyri-spesifik zolaq əldə etməsəniz və ya daha güclü fermentlərdən istifadə etməsəniz, aşağı yumşalma tempini sınamaq istəyə bilərsiniz. Həmçinin toxunma PCR xüsusi zolaqları səmərəli şəkildə əldə etmək üçün faydalı ola bilər.

Siz dNTP konsentrasiyasını artırdığınız zaman Mg++ effektləri susdurula bilər, çünki dNTP Chrisin şərh sütununda qeyd etdiyi kimi Mg++-nı xelatlaşdıra bilər.


Ω6 çoxlu doymamış yağ turşusu biosintezi yolunda sürəti məhdudlaşdıran genlərin skrininqi Nannochloropsis oceanica

Δ9 desaturazası Nannochloropsis oceanica substrat kimi stearin turşusuna üstünlük verilir.

Δ9 desaturazası monodoymamış yağ turşularının sintezi ilə əhəmiyyətli dərəcədə əlaqəli idi.

Δ12, Δ5 və Δ17 desaturazlar poli doymamış yağ turşularının sintezində sürəti məhdudlaşdıran fermentlər idi.

Çoxlu doymamış yağ turşularının sintezində yüksək azot və aşağı temperaturlu müalicələr rol oynamışdır.

Aşağı azot və yüksək temperatur monodoymamış yağ turşularının yığılması üçün faydalı olmuşdur.


Radiasiya biologiyasında irəliləyişlər

Andrew R.S. Collins, Robert T. Johnson, Advances in Radiation Biology, 1984

D DNT Prekursor Hovuzlarının Təmir üçün Münasibliyi

S fazalı siçan embrion hüceyrələrindəki dörd deoksiribonukleozid trifosfat (dNTP) hovuzundan dCTP hovuzu ən böyüyü, dGTP hovuzu isə ən kiçikdir (Skoog və Nordenskjöld, 1971). Yalnız 15-30 saniyəlik DNT sintezi üçün kifayət edən dGTP miqdarı HU əlavə edildikdə çox sürətlə azalır. HU-nun səbəb olduğu DNT sintezinin dayandırılması dGTP hovuzunun tükənməsinin kinetikasını çox yaxından izləyir. Digər trifosfat hovuzlarında dəyişikliklər müxtəlif və mürəkkəbdir, lakin HU-nun ribonukleotid reduktaza təsiri ilə sonrakı sintezin inhibə edilməsinə uyğundur. Bənzər sintezin, eynilə, prekursorların istehsalı bloklandıqda dayandırılacağı gözlənilir, lakin bərpa üçün lazım olan nukleotidlərin sayı replikasiya üçün lazım olanlarla müqayisədə azdır və buna görə də təmir DNT sintezi daim azalan sürətlə bir müddət davam etməlidir. hovuz tükəndikcə.

Əhəmiyyətli dərəcədə, MMS ilə müalicə olunan stimullaşdırılmamış limfositlərdə bərpaedici birləşmənin HU tərəfindən inhibə edilməsini nümayiş etdirmək qabiliyyəti (Cədvəl I Liberman və başqaları, 1971) bu hüceyrələrdə çox kiçik DNT prekursorları (xüsusilə dTTP) ilə əlaqələndirilir (Munch-Petersen) və başqaları, 1973 Tyrsted, 1975). Bununla belə, oxşar hüceyrələrdə UV-induksiya etdiyi təmir birləşməsi HU-ya həssas deyildi (Evans və Norman, 1968).

Xüsusi bir hal, təmirdə olan S faza hüceyrələri ilə təmsil olunur, həmçinin ümumi prekursor hovuzunu bölüşürlərsə replikativ sintez, HU əlavə edildikdə təmir və replikasiya eyni sürətli və şiddətli inhibəyə məruz qalmalıdır. Biz [3 H]BUdR ilə inkubasiyadan sonra CsCl qradient çöküntüsü ilə bərpanı replikasiya edən DNT-dən ayıraraq, S faza HeLa hüceyrələrində bu proqnozu sınaqdan keçirdik və tapdıq (Şəkil 14 Downes və Collins, 1982) replikativ sintez nəticəsində 3 H-nin birləşməsi. HU (ara C ilə) tərəfindən selektiv şəkildə inhibə edilmişdir. Beləliklə, görünür ki, təmir və replikasiya ümumi bir hovuzu paylaşmır və ya təmir polimerazası dNTP-lərə daha yüksək yaxınlıqda replikativ polimerazadan fərqlənir.

Şəkil 14. S fazasında HeLa hüceyrələrinin HU və ara C tərəfindən inhibəyə müqavimətini bərpa edin. UV şüalanmış (10 J m −2 ) (Δ, ▴) və ya şüalanmamış (O, •) hüceyrələrin BUdR ilə inkubasiyasından sonra təcrid olunmuş DNT-nin CsCl qradiyenti çökməsi və [3 H]timidin, (•, ▴) ilə və ya olmayan (O, Δ) HU (10 −2) M) və ara C (10 −4 M). Soldan sağa çökmə. (A) zirvələri BUdR ilə işarələnmiş replikasiya edilmiş DNT-ni təmsil edir. (B) normal sıxlıqlı DNT-yə BUdR-nin təmirə daxil olması səbəbindən 12-ci fraksiyada zirvəni göstərən gradientlərin yuxarı hissəsinin böyüdülmüş görünüşüdür. Bu zirvə aydın şəkildə HU və ara C ilə azalmır.

(Dauns və Kollinzdən, 1982, IRL Press Ltd.-nin icazəsi ilə)

Replikativ DNT sintezi, yəqin ki, “replitaz” adlanan, tərkibində, inter alia, DNT polimeraza α, ribonukleotid reduktaza və timidin kinazdan ibarət ferment kompleksi tərəfindən həyata keçirilir (Baril). və başqaları, 1974 Reddy və Pardee, 1980). Bu kompleks S fazasında nüvədə toplanır (Reddy və Pardee, 1980). Permeabilizasiya olunmuş hüceyrələrdə ribonukleozid difosfatlar (rNDPs) DNT sintezi üçün substrat kimi dNTP-lərə üstünlük verilirdi və Reddy və Pardee (1980) replitaz kanallarının ribonukleotid reduktaza vasitəsilə nüvədə dəqiq replikasiya sahəsinə rNDP-lərin ötürülməsini təklif edir. Ciarrocchi və b. (1979) oxşar keçirici hüceyrə sistemində replikativ sintezin substrat kimi timidini dTTP-dən üstün tutduğunu bildirir (halbuki təmir sintezi dTTP ilə optimal idi). Bu tapıntı Reddi və Pardinin tapıntılarına uyğundur, çünki timidin kinaz replitazanın tərkib hissəsidir. Bleomisinlə müalicədən sonra keçirici hüceyrələrdə bərpa sintezi replikativ sintezlə müqayisədə HU tərəfindən inhibəyə nisbətən həssasdır ( Castellot və başqaları, 1979). Bu tapıntıların sintezi göstərir ki, replikasiya polimerləşmədən dərhal əvvəl rNDP-lərin (yaxud deoksiribonukleozidlərin fosforilasiyası) koordinasiyalı fosforilləşməsini və reduksiyasını əhatə edir (buna görə də onun HU-ya həddindən artıq həssaslığı, ribonukleotid reduktaza komponentini bloklamaqla bütün kompleksin fəaliyyətini dayandıra bilər. ) və normal olaraq hüceyrənin dNTP hovuzundan istifadə etmir, halbuki təmir sintezi mövcud trifosfatlardan istifadə etməklə mükəmməl şəkildə həyata keçirilə bilər.


Nəticələr

Biz isti və ya soyuq sudan istilik ötürülməsi yolu ilə 1-dən 5 μL-ə qədər nümunələri 0,4-2,0 s-də temperatur dövriyyəsi üçün prototip alət qurduq (Onlayn Əlavə Şəkil 1-ə baxın). Nazik kapilyar borularda və ya polad iynələrdə nümunələr mexaniki olaraq su hamamları arasında istənilən temperatur dövriyyəsi profilini əldə etmək üçün çevrilmişdir. PCR məhlulunun temperaturu paralel nəzarət borusunda incə tel termocütlə ölçüldü.

Tək surətli genin 45 bp fraqmenti KCNE1 (kalium gərginliyə bağlı kanal, Isk ilə əlaqəli ailə, üzv 1) karusel LightCycler® alətində ekstremal PCR və ya adi sürətli dövr PZR ilə insan genomik DNT-sindən gücləndirilmişdir (Şəkil 1). 35 ekstremal PCR dövrü üçün 28 s (0,8 s/dövlə) tələb olundu, halbuki sürətli dövrəli PCR 12 dəqiqədə (20,6 s/dövrə) tamamlandı. Ekstremal PCR, sürətli dövriyyə alətində 2 dövr tamamlanmazdan əvvəl tamamlandı (Şəkil 1A). Hər iki üsul oxşar ərimə əyriləri və gel elektroforezində güclü, spesifik zolaqlar olan amplikonlar istehsal etdi, baxmayaraq ki, ekstremal PCR sürətli dövrəli PCR-dən daha çox məhsuldarlıq göstərdi (Şəkil 1, B və C). Ekstremal və sürətli dövrəli PCR üçün reaksiya komponentləri polimeraza və primerlərin miqdarı istisna olmaqla eyni idi. 0,8 saniyəlik dövrlərdən istifadə edən möhkəm PCR üçün primer konsentrasiyası ≥10 μmol/L və polimeraza konsentrasiyası ≥1 μmol/L tələb olunur. Yüksək polimeraza və primer konsentrasiyalarının sürətli dövrəli və real vaxt PCR-də məhsuldarlığı artırdığı bildirilmişdir (4, 16). Yüksək polimeraza və primer konsentrasiyalarına baxmayaraq, ekstremal PCR yalnız spesifik məhsulu yaratdı. Şablonlu və şablonsuz hər iki reaksiyada aşağı molekulyar çəkili primer zolaqları göründü. Hər 10 dövrədən bir qiymətləndirildikdə, məhsul ilk dəfə 30 dövrədə, 40-60 dövrədə yayla göründü (Şəkil 1D). İstifadə olunan genomik şablon konsentrasiyalarında yüksək effektivlikdə Cq dəyərləri adətən aşağı 20-lərdə olur, buna görə də biz 20 dövrədə gel zolaqlarının olmaya biləcəyini gözləyirik, xüsusən də kiçik 45-bp məhsulun boya aşkarlanması ilə.

45-bp seqmentinin DNT gücləndirilməsi KCNE1 ekstremal PCR (<30 s) və adi sürətli dövrəli PCR (12 dəq) ilə 35 sikllə [primerdə] 20 dəfə (10-a qarşı 0,5 μmol/L) və [polimeraza] 16 dəfə artım (1,0 ilə müqayisədə) 0,064 μmol/L) gücləndirmə vaxtını 26 dəfə azaltmağa imkan verdi.

(A), 35 ekstremal PCR dövrü (0,8 s/dövrə qırmızı) və sürətli dövrəli PCR (mavi rəngdə 20,6 s/dövlə, LightCycler karuselində əldə edilmiş) üçün nümunə temperaturu ilə vaxt. (B), İnsan genomik DNT-sindən və şablonsuz nəzarətlərdən (NTC) gücləndirilmiş PCR məhsullarının yüksək ayırdetmədə əriməsi. The Tm Polimeraza saxlama tamponlarından yaranan qliserol konsentrasiyalarında (müvafiq olaraq 1,3% -ə qarşı 0,1%, həcm/həcm) fərq səbəbindən ekstremal PCR məhsulu sürətli dövr məhsulundan bir qədər azdır. The y-d kimi qısaldılmış ox etiketiF/dT, temperatura görə flüoresansın mənfi ilk törəməsidir. (C), ekstremal (0,8 s dövrlər) və sürətli dövr (20,6 s dövrlər) PCR-dən sonra agaroza gel elektroforezi. Aşağı zolaqlar yüksək primer konsentrasiyası ilə əlaqələndirilir. (D), 10-60 ekstremal PCR dövründən sonra agaroz gel elektroforezi.

(A), 35 ekstremal PCR dövrü (0,8 s/dövrə qırmızı) və sürətli dövrəli PCR (mavi rəngdə 20,6 s/dövlə, LightCycler karuselində əldə edilmiş) üçün nümunə temperaturu ilə vaxt. (B), İnsan genomik DNT-sindən və şablonsuz nəzarətlərdən (NTC) gücləndirilmiş PCR məhsullarının yüksək ayırdetmə ilə əriməsi. The Tm Polimeraza saxlama tamponlarından yaranan qliserol konsentrasiyalarında (müvafiq olaraq 1,3% -ə qarşı 0,1%, həcm/həcm) fərq səbəbindən ekstremal PCR məhsulu sürətli dövr məhsulundan bir qədər azdır. The y-d kimi qısaldılmış ox etiketiF/dT, temperatura görə flüoresansın mənfi ilk törəməsidir. (C), ekstremal (0,8 s dövrlər) və sürətli dövr (20,6 s dövrlər) PCR-dən sonra agaroza gel elektroforezi. Aşağı zolaqlar yüksək primer konsentrasiyası ilə əlaqələndirilir. (D), 10-60 ekstremal PCR dövründən sonra agaroz gel elektroforezi.

PCR-də polimeraza və primer konsentrasiyalarının <1-s dövrlərlə təsiri IL10RB (interleykin-10 reseptoru, β), həm 2 ölçülü ( Şəkil 2A ) həm də 1 ölçülü ( Şəkil 2, B və C ) məlumatlar kimi göstərilmişdir. Məhsul məhsuldarlığı 92 °C və 63 °C arasında 0,73 s orta dövr müddəti ilə 35 dövrədən sonra müəyyən edilmişdir. Yalnız primer konsentrasiyaları ≥5 μmol/L və polimeraza konsentrasiyaları ≥1 μmol/L olduqda PCR məhsulları aşkar edilmişdir. Reaksiya qabları, 20 μmol/L primerlər və 8 μmol/L polimeraza kimi 19 ölçülü dərialtı iynələrdən istifadə edərək, 92 °C ilə 65 °C arasında 35 dövrə istifadə edərək 49-bp fraqmentinin gücləndirilməsi vaxtı daha da 16 saniyəyə endirildi ( Şəkil 2D). Bundan əlavə, yüksək həlledici ərimə ilə genotipləşdirmə 58 bp seqmentində uğurlu olmuşdur. IL10RB 10 μmol/L primerlər və 2 μmol/L polimeraza ilə 38-s PCR-dən sonra A>G variantının yan tərəfi (onlayn Əlavə Şəkil 3-ə baxın).

49-bp seqmentinin həddindən artıq PCR gücləndirilməsi IL10RB.

(A), hər biri 0,73 s olmaqla 35 dövrədən sonra məhsul məhsuldarlığı üçün polimeraza və primerin optimallaşdırılması. PCR məhsulunun məhsuldarlığı törəmə ərimə əyrilərinin pik nöqtəsi kimi ölçüldü. (B), Törəmə ərimə əyriləri 4 μmol/L polimerazadan istifadə edərkən primer konsentrasiyasının məhsulun məhsuldarlığına təsirini nümayiş etdirir. (C), polimeraza konsentrasiyasının hər bir primerdən 10 μmol/L istifadə edərək gücləndirmə məhsuldarlığına təsirini göstərən agaroza gel. (D), 49-bp seqmentinin on altı saniyəlik gücləndirilməsi IL10RB (35 dövr, 0,45 s/dövlə) hər bir primerdən 20 μmol/L və 8 μmol/L polimeraza malik reaksiya qabları kimi 19-qabar dərialtı iynələrdən istifadə etməklə. NTC, şablonsuz nəzarət. −dF/dT, temperatura görə flüoresansın mənfi birinci törəməsi.

(A), hər biri 0,73 s olmaqla 35 dövrədən sonra məhsul məhsuldarlığı üçün polimeraza və primerin optimallaşdırılması. PCR məhsulunun məhsuldarlığı törəmə ərimə əyrilərinin pik nöqtəsi kimi ölçüldü. (B), Törəmə ərimə əyriləri 4 μmol/L polimerazadan istifadə edərkən primer konsentrasiyasının məhsulun məhsuldarlığına təsirini nümayiş etdirir. (C), polimeraza konsentrasiyasının hər bir primerdən 10 μmol/L istifadə edərək gücləndirmə məhsuldarlığına təsirini göstərən agaroza gel. (D), 49-bp seqmentinin on altı saniyəlik gücləndirilməsi IL10RB (35 dövr, 0,45 s/dövlə) hər bir primerdən 20 μmol/L və 8 μmol/L polimeraza malik reaksiya qabları kimi 19-qabar dərialtı iynələrdən istifadə etməklə. NTC, şablonsuz nəzarət. −dF/dT, temperatura görə flüoresansın mənfi birinci törəməsi.

Optimal polimeraza və primer konsentrasiyaları da 102 bp fraqmenti ilə tədqiq edilmişdir. NQO1 92 °C və 72 °C arasında 1,93-s dövrələrdən istifadə etməklə (onlayn Əlavə Şəkil 4-ə baxın). 49-bp-ə bənzəyir IL10RB hədəf, gücləndirmə üçün həm artan primerlər (≥2 μmol/L), həm də polimeraza (≥0.5 μmol/L) tələb olunur. Bununla belə, fraqment ölçüsü artdıqca, tam uzadılması üçün daha uzun tavlama/uzatma vaxtları tələb olunur və daha aşağı reagent konsentrasiyaları istifadə edilə bilər.

Ekstremal PCR prototipi real vaxt rejimində monitorinq üçün optika daxil etmək üçün daha da dəyişdirildi (onlayn Əlavə Şəkil 2 və Əlavə Videoya baxın). 102-bp fraqmenti üçün ekstremal PCR-in kəmiyyət göstəricisi NQO1 [NAD(P)H dehidrogenaz, quinon 1] (Şəkil 3) və 45-bp fraqmenti KCNE1 (Onlayn Əlavə Şəkil 5-ə baxın) insan genomik DNT-nin seyreltmə seriyasından istifadə etməklə qiymətləndirilmişdir. Ən azı 4 log dinamik diapazonla, kalibrləmə əyrilərindən hesablanmış gücləndirmə səmərəliliyi 95,8% idi. NQO1 və 91,7% üçün KCNE1, adi PCR-ə bənzəyir. Şablonsuz nəzarət reaksiyaları 50 dövrədən sonra güclənmədi. Tək nüsxə təkrarları (bir reaksiya üçün orta nüsxə sayı 1,5 nüsxə) gücləndirmə əyrisi şəklində və intensivliyində daha yüksək konsentrasiyalara oxşar idi (Şəkil 3 və onlayn Əlavə Şəkil 5). Orta nüsxə sayı 0,15 nüsxə/reaksiya zamanı 17 reaksiyadan 2-si müsbət idi (hər ikisini birləşdirən) NQO1KCNE1 sınaqlar), binomial genişlənmə ilə 0,13 nüsxə/reaksiya hesablanmış gözlənti ilə (rəqəmsal PCR üçün uCount, https://dna.utah.edu/ucount/uc.php 7 may 2014-cü ildə əldə edilmişdir).

Effektivlik və həssaslıq həddindən artıq PCR tərəfindən pozulmur.

(A), Floresensiyaya qarşı dövr sayı. (B), Cq və log10 (ilkin şablon nüsxələri) 102 bp fraqmentinin gücləndirilməsi üçün planlar NQO1 (50 dövr, 1,93 s/dövlə). Reaksiyalar 2 μmol/L polimeraza və hər bir primerin 8 μmol/L ilə dörd dəfə həyata keçirildi. Hesablanmış səmərəlilik 95,8% təşkil etmişdir.

(A), Floresensiyaya qarşı dövr sayı. (B), Cq və log10 (ilkin şablon nüsxələri) 102 bp fraqmentinin gücləndirilməsi üçün planlar NQO1 (50 dövr, 1,93 s/dövlə). Reaksiyalar 2 μmol/L polimeraza və hər bir primerin 8 μmol/L ilə dörd dəfə həyata keçirildi. Hesablanmış səmərəlilik 95,8% təşkil etmişdir.

Biz həmçinin real vaxt PCR-dən istifadə etməklə müxtəlif məhsul uzunluqları üçün tələb olunan uzadılma müddətini araşdırdıq (şək. 4). Müxtəlif primerlərin mümkün qarışıq təsirlərinin qarşısını almaq üçün ümumi yüksək ərimə temperaturu olan 100-500 bp sintetik şablonlar (Tm, 77 °C) primerlərdən istifadə edilmişdir. Primerlərin və polimerazanın optimal konsentrasiyaları ilk olaraq 300-bp məhsul üçün 4,9-s dövrü ilə 4-s birləşdirilmiş yumşalma/uzatma seqmentindən istifadə etməklə müəyyən edilmişdir (Şəkil 4A). Eyni primer (4 μmol/L) və polimeraza (2 μmol/L) konsentrasiyaları daha sonra bütün məhsul uzunluqları üçün istifadə edildi və minimum uzadılma vaxtları müəyyən edildi (bax. Onlayn Əlavə Şəkil 6). Hər bir məhsul uzunluğu üçün artan yumşalma/uzatma vaxtları, effektiv PCR üçün tələb olunan minimum uzatma müddətini əks etdirən əlavə dəyişiklik müşahidə olunmayana qədər fraksiya Cq dəyərlərinin azalması ilə nəticələndi. Məsələn, 500-bp məhsul üçün KAPA2G FAST polimerazının istifadəsi ilə gücləndirmə əyriləri Şəkil 4B-də göstərilmişdir. KAPA2G FAST polimerazasının istifadəsi ilə minimum uzadılma müddəti KlenTaq1 (silinmə mutantı) ilə 7 s ilə müqayisədə 3 s olmuşdur. Taq polimeraza). Daha uzun məhsullar üçün daha uzun müddət tələb olunur (şək. 4C). KlenTaq1 polimeraza üçün hər 60 bps üçün təxminən 1 s, KAPA2G FAST üçün isə hər 158 bps üçün 1 s tələb olunur.

Tələb olunan uzadılma vaxtları PCR məhsulunun uzunluğundan və gücləndirmə üçün istifadə olunan polimerazanın növündən asılıdır.

(A), 300-bp sintetik şablonun gücləndirilməsi üçün polimeraza və primerin optimallaşdırılması (20 dövr, 4,9 s/dövr). Gücləndirmə üçün 76 °C-də 4 saniyəlik birləşmiş yumşalma/uzatma addımı istifadə edilmişdir. (B), KAPA2G FAST polimeraza və 1-dən 5-ə qədər uzadılma müddətindən istifadə edərək 500-bp sintetik şablonun PCR gücləndirilməsi üçün Floresensiyaya qarşı dövr sayı qrafikləri. (C), 2 μmol/L polimeraza və hər bir primerdən 4 μmol/L istifadə edərək 100-dən 500-bp-ə qədər sintetik şablonların səmərəli gücləndirilməsi üçün tələb olunan minimum müşahidə olunan uzatma vaxtları. Uzatma uzunluqları astarları nəzərə almaq üçün məhsul uzunluqlarından kiçikdir. Məhsulun ölçüsünü əlaqələndirən təxmini tənlik (səh) baza cütlərində proqnozlaşdırılan minimum uzadılma vaxtına (t) s ilədir t = 0.016səh − 2 μmol/L KlenTaq polimeraza ilə 0,2 və 76 °C-də hər bir primerdən 4 μmol/L. −dF/dT, temperatura görə flüoresansın mənfi birinci törəməsi.

(A), 300-bp sintetik şablonun gücləndirilməsi üçün polimeraza və primerin optimallaşdırılması (20 dövr, 4,9 s/dövr). Gücləndirmə üçün 76 °C-də 4 saniyəlik birləşmiş yumşalma/uzatma addımı istifadə edilmişdir. (B), KAPA2G FAST polimeraza və 1-dən 5-ə qədər uzadılma müddətindən istifadə edərək 500-bp sintetik şablonun PCR gücləndirilməsi üçün Floresensiyaya qarşı dövr sayı qrafikləri. (C), 2 μmol/L polimeraza və hər bir primerdən 4 μmol/L istifadə edərək 100-dən 500-bp-ə qədər sintetik şablonların səmərəli gücləndirilməsi üçün tələb olunan minimum müşahidə olunan uzatma vaxtları. Uzatma uzunluqları astarları nəzərə almaq üçün məhsul uzunluqlarından daha kiçikdir. Məhsulun ölçüsünü əlaqələndirən təxmini tənlik (səh) baza cütlərində proqnozlaşdırılan minimum uzadılma vaxtına (t) s ilədir t = 0.016səh − 2 μmol/L KlenTaq polimeraza ilə 0,2 və 76 °C-də hər bir primerdən 4 μmol/L. −dF/dT, temperatura görə flüoresansın mənfi birinci törəməsi.

Yüksək Mg 2+ konsentrasiyası ekstremal PCR-ni asanlaşdırır. Zaman 60-bp fraqmenti AKAP10 [A kinaz (PRKA) anker proteini 10] 20 μmol/L primerlər və 8 μmol/L polimeraza ilə 35 dövr üçün gücləndirildi, 2-3 mmol/L-də gellərdə heç bir məhsul müşahidə olunmadı, 4 mmol/L-də minimal məhsul, və 5-7 mmol/L MgCl-də böyük miqdarda xüsusi məhsul2 (Onlayn Əlavə Şəkil 7-ə baxın). 5 mmol/L MgCl-də2, səmərəli gücləndirmə üçün minimum dövr müddəti 0,42 s idi (Onlayn Əlavə Şəkil 7-ə baxın), bu, insan genomik DNT-dən 15 s ərzində xüsusi, yüksək məhsuldar 60-bp məhsulun əldə edilə biləcəyini nümayiş etdirir (14,7 s-də 35 dövr).


Pankreas Xərçənginin Gemcitabine qarşı müqaviməti

Gemcitabine və Chemoresistance

Gemsitabin qəbul edən mədəaltı vəzi adenokarsinoması olan xəstələrdə kimyəvi müqavimət ilkin müalicə uğursuzluğu mənbəyidir. Xəstələrin əksəriyyəti ardıcıl müalicə dövrlərindən sonra dərmana rezistent olur, bu da kemoterapinin uğursuzluğu ilə nəticələnir və beləliklə, kimyəvi müqavimətin arxasındakı mexanizmləri aydınlaşdırır. Gemsitabinlə daha yaxşı müalicə variantlarını planlaşdırmaq üçün həm əldə edilmiş, həm də xas olan kimyəvi müqavimətin proqnozlaşdırıcı markerlərinin müəyyən edilməsi məcburi hala gəldi.

Gemsitabinin metabolizmi və nəqli arasında hüceyrə fermentlərinin modulyasiyası dərmanın in vitro fəaliyyətinə təsir göstərə bilər [27-30]. HENT1, RRM1, dCK və RRM2 hüceyrə fermentləri gemsitabinin metabolizmində qeydə alınır. Eksperimental sübutlar, gemsitabinin təsirini dərmanların selektiv birləşməsi ilə modulyasiya etməyi dəstəkləyir və bununla da mədəaltı vəzi xərçəngi hallarında müalicənin müvəffəqiyyət dərəcəsini artırır. HENT1, RRM1, dCK və RRM2-nin valideyn hüceyrə xətlərində və rezistent subklonlarında transkripsiya təhlili aparılıb və onlar gemsitabinə müqaviməti kodlayan proqnozlaşdırıcı markerləri müəyyən etmək üçün davamlı olaraq gemsitabinə məruz qalıblar. Bu məlumatlar göstərdi ki, bədxassəli hüceyrələrin gemsitabin preparatına əldə edilmiş və xas olan kimyəvi müqaviməti dCK, RRM1, RRM2 və hENT1 gen ifadələrinin balanslaşdırılması ilə təsdiqlənir. Bu genlərin ifadə nisbəti, gemsitabinə qarşı müqavimət əldə etmiş hüceyrələr də daxil olmaqla, xərçəng hüceyrələrində gemsitabinə qarşı müqavimətlə əhəmiyyətli dərəcədə korrelyasiya olunur, bu nisbətin azalmasının xərçəng hüceyrələrinin gemsitabinə xas və qazanılmış kimyəvi müqavimətinə təsir göstərə biləcəyini və başa düşmək üçün bir nöqtə olduğunu göstərir. fərdi pankreas xərçəngi xəstələrində gemsitabinin effektivliyi. İfadə nisbəti mədəaltı vəzi xərçəngi xəstəsinin gemsitabinə reaksiyalarını proqnozlaşdırmaqda və izləməkdə informativ marker ola bilər.

Xərçəng hüceyrə xətləri üzərində in vitro aparılan bir araşdırma hENT1-in pankreas xərçəngi hüceyrələrində əsas gemsitabin daşıyıcısı olduğunu bildirdi [31]. HENT1-in az bolluğu olan hüceyrə populyasiyasının hüceyrədaxili yığılmanın minimuma endirilməsi səbəbindən gemsitabinə davamlı ola biləcəyi güman edilir. Pankreas xərçəngi hüceyrələrində hENT1 inhibəsinin gemsitabinə qarşı müqavimət göstərdiyi bildirilir [27]. Digər tədqiqatlar, hENT1 geninin ifadəsinin gemsitabinə qarşı müqavimətin inkişafı zamanı heç də azalmadığını və səkkiz hüceyrə xətti daxilində dərmanın IC50 dəyərləri ilə korrelyasiya olunmadığını fərz etdi. Bu hesabatlar tək hENT1 ifadəsinin gemsitabinə qarşı müqaviməti əks etdirmədiyini göstərə bilər. PCI-G4000, PK1-G4000 və KLM1-G4000 subklonlarında hENT1-in ifadə nümunələrinin artması gemsitabinə yüksək səviyyəli kimyəvi müqavimətə uyğunlaşmadır.

Heyvan modellərindəki əvvəlki hesabatlar, qazanılmış rezistentliyə malik xərçəng hüceyrələrində gemsitabin müqavimətinin arxasında əsas mexanizm kimi dCK mutasiya çatışmazlığını nümayiş etdirdi [32-34]. Lakin aşağı gemsitabin konsentrasiyalarına davamlı olan və yüksək müqavimətə malik subklonlarda, yəni PK1-G4000 və PCI43-G4000-də aşkar olunmayan subklonlarda dCK geninin ifadə səviyyələri artmışdır. Bundan əlavə, tək başına dCK gen ifadəsi səkkiz xərçəng hüceyrə xətti arasında gemsitabin həssaslığı ilə əlaqələndirilə bilməz. Digər hesabatlarda təsvir edilən dCK çatışmazlığı yüksək dərəcədə davamlı olan və klinik şəraitdən fərqlənən gemsitabin klonları üzərində aparılan təcrübələrə əsaslanırdı. Bu cür məlumatlar dCK çatışmazlığının nə aşağı dərəcəli rezistent hüceyrələrdə, nə də valideyn hüceyrələrində, gemsitabinə qazanılmış müqavimətin yüksək dərəcəsi ilə əlaqəli ola biləcəyini irəli sürür.

RR ifadəsinin insan şiş hüceyrələri arasında gemsitabinin kimyəvi müqavimətini təyin etdiyi məlumdur [35]. RRM2-nin süni şəkildə həddən artıq ekspressiyası gemsitabin kimyəvi müqavimətini inkişaf etdirir [29]. RR-nin yüksək səviyyələri dNTP hovuzunun ölçüsünü artırır, beləliklə, gemsitabin trifosfatın hüceyrə DNT-yə daxil edilməsi maneə törədilir [36]. Genişləndirilmiş dNTP hovuzları mənfi rəy yolu ilə dCK-nın fəaliyyətini aşağı salır. Tədqiqatın nəticələri göstərdi ki, RRM1 mRNT ifadə səviyyəsi KLM1 gemsitabinə davamlı hüceyrələrdə valideyn hüceyrələrinə nisbətən artıb. Bu nəticə RRM1-in ağciyər xərçənginin hüceyrə xətləri arasında gemsitabinə qarşı müqavimətini proqnozlaşdırmaq üçün bir marker olduğu hesabatını dəstəkləyir [37]. KLM1 gemsitabinə davamlı hüceyrələr dCK çatışmazlığı barədə məlumat vermədilər, PK1 və PCI43 gemsitabinə davamlı hüceyrələrdə dCK çatışmazlığı bildirildi. Beləliklə, bu məlumatlar göstərir ki, RRM1 dCK çatışmazlığı olmayan hüceyrələrdə gemsitabinə qarşı əldə edilmiş müqavimətlə əlaqələndirilə bilər. RRM2 mRNA-nın KLM1 və PK1 gemsitabinə davamlı subklonlarda deyil, PCI43 gemsitabinə davamlı hüceyrələrdə artdığı aşkar edilmişdir. Səkkiz mədəaltı vəzi karsinoması sınaqdan keçirilmiş hüceyrədə, gemsitabinə xas müqaviməti yüksək olan hüceyrələr yüksək səviyyədə RRM1 və RRM2 ifadələrini nümayiş etdirə bilmədilər. Bu nəticələr RRM1 və ya RRM2 ifadələrində artımın qazanılmış kimyəvi müqavimətlə əlaqəli olduğunu və gemsitabinə xas olan kimyəvi müqavimətə təsir göstərmədiyini göstərir. Gemsitabinə rezistentliyin inkişafı zamanı RRM1 və ya RRM2 ifadəsinin artması, əlavə olaraq dCK-nın azalması, hüceyrələrin gemsitabinə davamlı hüceyrələrə gemsitabinin daxil olması ilə zədələnməsini maneə törətdiyini göstərir.

Ribonükleotid reduktaza dNTP sintez sürətinə nəzarət edən mərkəzi fermentdir [36]. Tioredoksin in vitro RR reaksiyası üçün məcburi olan ribonukleotidlərin azaldılmasında fizioloji amildir [38]. Mayada, tioredoksinsiz mutantların əhəmiyyətli dərəcədə aşağı dNTP səviyyələri var ki, bu da tioredoksin in vitro RR reduktantı kimi fəaliyyət göstərə biləcəyi fikrini təsdiqləyir. Tioredoksin, Smad7-nin ümumiyyətlə həddindən artıq ifadə olunduğu pankreas xərçəngi hüceyrələrində ifadə səviyyələri artan bir gen kimi qeyd olunur [39]. Tioredoksin, böyüməni təşviq edən və pankreas xərçəngi hüceyrələri arasında apoptoza qarşı müqavimət göstərən Smad7 yolunun aşağı axını kimi tanınır. Gemsitabinə davamlı xərçəng hüceyrələrində tioredoksinin aşağı tənzimlənməsinin olub olmadığını araşdırmaq üçün gələcək tədqiqatlar tələb olunur.

Mədəaltı vəzi xərçənginin genomikası üzrə əvvəlki analizlər cərrahi və yarılma nümunələri ilə aparılıb, çünki cərrahi proses olmadan toxuma nümunələrinin əldə edilməsi çətinləşib. Bu problemi aradan qaldırmaq üçün mədəaltı vəzi xərçənginin diaqnozunda təhlükəsiz üsul kimi şiş hüceyrələrini əldə etmək üçün EUS-İİAB aparılır [40]. Bu yaxınlarda tədqiqatçılar xərçəng mərhələsini təyin etmək və diaqnostik dəqiqliyi artırmaq üçün EUS-FNAB nümunələrindən istifadə edərək aparılan genetik analizi nümayiş etdirdilər [41, 42]. HENT1, dCK, RRM1 və RRM2 mRNA-nın aşkarlanması və kəmiyyəti SYBR Yaşıl flüoresansı ilə birlikdə işıq dövranı PCR istifadə edərək sürətlə həyata keçirildi. Light cycler-PCR və EUS-FNAB nümunələrinin analitik strategiyaları gemsitabin müalicəsi zamanı mədəaltı vəzi xərçənginin kimyəvi müqavimətini qiymətləndirdi. Kəmiyyət RT-PCR analizi dörd gen ifadə səviyyəsi arasında tarazlığı nümayiş etdirdi və xərçəng hüceyrələrində gemsitabinə xas və qazanılmış müqavimətlə əlaqələndirildi. Pankreas xərçəngi hüceyrələrinin dərman gemsitabinə qarşı müqaviməti bu genlərin mədəaltı vəzi xərçəngi hüceyrələrində ifadə nisbətlərinin öyrənilməsi ilə müəyyən edilə bilər. Gen ifadəsinin nisbətləri mədəaltı vəzi xərçəngi xəstələri arasında bu gemsitabin terapiyasının effektivliyinin proqnozlaşdırılmasında və monitorinqində faydalı marker ola bilər. Pankreas xərçəngi üçün gemsitabin müalicəsində ifadə nisbətinin üstünlüyünü aydınlaşdırmaq üçün EUS-FNAB tərəfindən toplanmış mədəaltı vəzi xərçəngi toxumalarından istifadə etməklə əlavə tədqiqatlar davam edir.


MATERİALLAR VƏ METODLAR

İdarəetmə Ksenop oositlər və mikroinyeksiya təcrübələri

X. laevis oositlər və yumurtalar OR2-tamponda (82,5 mM NaCl, 2,5 mM KCl, 1 mM CaCl) saxlanıldı.2, 1 mM MgCl2, 1 mM Na2HPO4, 5 mM 4-(2-hidroksietil)-1-piperazineetansülfonik turşu, pH 8.3) 16°C-də (Wallace) və b., 1973). Oositlər 20 μg/ml progesteron əlavə edilərək və bir gecədə 16°C-də inkubasiya edilərək yumurtalara yetişdi. X. laevis yumurtalar görünən germinal vezikül parçalanması üçün seçilmişdir. Nüvə və sitoplazmik inyeksiyalar Eppendorf mikroinjektorundan istifadə etməklə həyata keçirilib. Sitoplazmalara 50 nl-ə qədər (500 ng/mkl) Droşa kodlayan mRNT yeridilib. Pri- və pre-miRNA-lar hər nüvəyə və ya sitoplazmaya 5-10 nl enjekte edilmişdir. RNT-lər 200-500 ng/μl konsentrasiyalarda yeridildi.

Nüvə enjeksiyonları üçün oositlər heyvan dirəyi 800 × yuxarıya baxaraq sentrifuqa edilmişdir. g 20 dəq. Bu, germinal vezikülün heyvan yarımkürəsində parlaq bir nöqtə kimi görünməsi ilə nəticələnir.

Ümumi RNT-nin çıxarılması istehsalçının protokoluna uyğun olaraq Invitrogen (Carlsbad, CA) TRIzol reagentindən istifadə etməklə həyata keçirilmişdir. RNT 1x Tris/borat/EDTA (TBE) tərkibində 8 M karbamid olan 10% 29:1 akrilamid:bis-akrilamid gellərində ayrıldı.

Bio-Rad Quantity One proqram təminatından istifadə edərək üç müstəqil eksperimentdə bir fosfoimagerdə ​​işlənmiş və işlənməmiş zolaqların kəmiyyəti aparılmışdır. Ekspozisiyada doymuş piksellərin olmamasına diqqət yetirildi.

T7 promotorunu ehtiva edən miRNA variantlarının klonlanması

T7 RNT polimeraza ilə transkripsiya edilmiş in vitro ola bilən DNT konstruksiyalarını istehsal etmək üçün biz 1 μg insan genomik DNT-dən gücləndirilmiş miRNA sekanslarını PCR etdik. Transkripti sabitləşdirmək üçün biz pri-miRNA ardıcıllığının 3′ sonunda süni 40 nt uzunluğunda poli(A) quyruğu yerləşdirdik.

PCR məhsulları Promega (Madison, WI) pGEM-Teasy vektorunda klonlanmış və ardıcıllıqla yoxlanılmışdır.

Aşağıdakı ardıcıllıqlar klonlandı (T7 promotor ardıcıllığı qalın hərflərlə göstərilmişdir):

TAATACGACTCACTATAGGACATCTCCATGGCTGTACCACCTTGTCGGGTAGCTTATCAGACTGATGTTGACTGTTGAATCTCATGGCAACACCAGTCGATGGGCTGTCTGACATTGGGTATCTTTCATCTGACCATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

TAATACGACTCACTATAGGGTCTTGGGTTTATTGTAAGAGAGCATTATGAAGAAAAAAATAGATCATAAAGCTTCTTCAGGAAGCTGGTTTCATATGGTGGTTTAGATTTAAATAGTGATTGTCTAGCACCATTTGAAATCAGTGTTCTTGGGGGAGACCAGCTGCGCTGCACTACCAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

TAATACGACTCACTATAGGAGTTCTGTGACACTTAGACTCTGAATATGATAGCAGTCAGTGCACTACAGAACTTTGT

TAATACGACTCACTATAGGGTCTTGGGTTTATTGTAAGAGAGCATTATGAATAGTCTTTTAAATCAAAGTTCTGTGACACTTAGACTCTGAATATGATAGCAGTCAGTGCACTACAGAACTTTGTTTTGGGAGTCTGGGCTGCGCTGCACTACCAACAGCAAAAGAA

TAATACGACTCACTATAGAAGACTATATTTTCAGGGATCATTTCTACAGTGCACTACTAGAGAAGTTTCTGTGAACTTGTAGAGCACCGGAAACCATGAGCAGGAAGTGCAGCGTTCTCTCCTGAGCATGAAGCCGGCTCTTGGTGTGTGTGCTTCGCTGCAACTGCCAT

TAATACGACTCACTATAGGTGCTCATTTTGGCAGCACATATACTAAAAATTAGAACACTGCAGAGAAGATTAGCATGGCCCCTGCACAAGGATGACAATAAAAAATTAAAAAATGAATTT

T7 in vitro transkripsiyası

In vitro transkripsiya üçün Drosha şablonunu ehtiva edən plazmid 3′ ucunda xəttiləşdirilmişdir. 500 ng şablon DNT istifadə edərək T7 in vitro transkripsiyası 10 mM ditiotreitol, 1 × Stratagene (La Jolla, CA) transkripsiya tamponunda, 0,3 mM GpppGTP (qapaq), 0,5 mM CTP, 0,5 mkMTP, 0,5 mMTP, 1 UTP-də həyata keçirilib. (40 U) RNaz inhibitoru və T7 RNT polimeraza. Qapaqlı transkriptlər üçün qapaq analoqu ilə 10 dəqiqəlik preinkubasiyadan sonra 0,1 mM GTP əlavə edildi. Reaksiya 37°C-də 2 saat inkubasiya edildi, Sephadex G-25 sütunlarından istifadə edilərək təmizləndi və çökdürüldü. Radioaktiv etiketli RNT istehsalı üçün nukleotid qarışığına 0,1 mM ATP və 30 μCi [α- 32 P]ATP əlavə edildi, digər nukleotidlər isə 0,3 mM-də qaldı.

İn vitro transkriptlər 10 və ya 15% 29:1 AA:bis-AA gellərində (1x TBE-də 8 M karbamid) ayrılmışdır. Yaş gel rentgen filmlərinə məruz qaldı və müvafiq zolaqlar kəsildi və 400 μl elüsyon tamponunda (500 mM NH) elüt edildi.4OAc, 0,2% SDS, 100 mM EDTA) bir gecədə. Elut edilmiş nümunələr Sephadex G-25 sütunları üzərində təmizləndi və çökdürüldü.

Şimal ləkəsi

Şimal ləkələri təsvir edildiyi kimi edildi (Pall və Hamilton, 2008). Qısaca, ümumi RNT 35 oositdən və ya yumurtadan təcrid edilmişdir. Oosit və yumurta ümumi RNT-nin bərabər miqdarı RiboGreen florometrik kəmiyyəti ilə təsdiq edilmişdir. İzolyasiya edilmiş RNT-lər 15% poliakrilamid geldə ayrılmışdır. Gels were blotted onto Hybond N+ membrane (GE Healthcare, Freiburg, Germany) using a semidry blotting technique. For hybridization, oligonucleotides xtr-miRNA-101, 5′-CTTCAGTTATCACAGTACTGTA-3′, and xtr-miRNA-148a, 5′-ACAAAGTTCTGTAATGCACTGA-3′, were 5′-end labeled with 20 μCi of [γ- 32 P]ATP using T4 polynucleotide kinase according to manufacturer's protocol. Hybridization was carried out as described (Pall and Hamilton, 2008). Blots were exposed to phosphoimager screens, and signals were detected using an FX Pro phosphoimager. Quantification and integration of signals of equally sized squares were done using Quantity One Software.

Immunoprecipitation of recombinant Drosha

Oocytes and eggs (10 cells) injected with N-terminally tagged 7xmyc-Drosha-poly(A) RNA were homogenized, and 100 μl of NET-2 (150 mM NaCl, 50 mM Tris, pH 7.4, 0.05% NP-40) buffer was added. The mixture was spun for 5 min at 14,000 rpm, and the supernatant was transferred to a fresh tube. An aliquot of one cell (10 μl) was transferred to a fresh tube and saved for Western blotting (input control).

The α-myc antibody 9E10 was coupled to Sepharose A beads (4 mg of beads in 5 ml of 9E10) overnight at 4°C. The coupled beads were washed four times in NET-2 buffer and resuspended in 500 μl of NET-2 buffer. Supernatants of cell extracts were added to the resuspended antibody-coupled beads and incubated for 1 h at 4°C on a rotating wheel. The beads were washed four times with NET-2 buffer and resuspended in 500 μl of NET-2 buffer. An aliquot of one cell (50 μl) was transferred to a fresh tube for Western blotting (purification control). The remaining immunoprecipitate was washed in 500 μl of 6.4 mM MgCl2 and used for Drosha in vitro processing assay.

Drosha in vitro processing assay

Capped, in vitro–transcribed RNA encoding myc-tagged Drosha was injected in oocytes, and half of the cells were matured to eggs. Cells were lysed, and lysates were used to immunoprecipitate the translated Drosha protein using α-myc antibody coupled to protein A– Sepharose following the protocol described by Steitz (1989). The precipitated material was used for an in vitro processing assay with protein still coupled to beads as described at www.narrykim.org/in_vitro_Drosha_processing.pdf.

After processing, the cleaved RNA was boiled in 8 M urea and loaded on a 10% urea polyacrylamide gel.

Cloning of processed pre-miRNAs

Nuclear or cytoplasmic RNA isolations were run on polyacrylamide gels next to radioactively labeled markers. After a short exposure of the wet gel to film, the region of interest was excised, and RNAs were extracted by macerating the gel in 500 mM NH4Ac and 0.1% SDS with overnight incubation. Extracted RNAs were precipitated, and cDNA synthesis was done with a primer overlapping the template by eight nucleotides. cDNA synthesis was first performed at 16°C and then extended at room temperature. After cDNA synthesis, PCR was performed with the primer used for cDNA synthesis and a 5′ primer overlapping the cDNA again by eight nucleotides. PCR products were gel purified, cloned, and sequenced. Of 24 clones sequenced, 3 contained the correct and expected sequence.

Reverse transcription quantitative PCR

For the quantification of Drosha, total RNA prepared from stage VI oocytes and unfertilized eggs was DNase I digested (1 U/μl, 10 U Fermentas) and reverse transcribed using M-MLV Reverse Transcriptase (Thermo Scientific, Waltham, MA) and random hexamers in a total volume of 20 μl. Real-time PCR was performed on a Bio-Rad iQ5 Mastercycler, using GoTaq SYBR Green qPCR master mix (Promega, Madison, WI) and the following primers. Drosha: sense, 5′-CCTTTATCGCTGCCCTTTAT-3′ antisense, 5′-CCATCTGGGGGAAGTTATAT-3′. Smn2: sense, 5′-ATAGGAGACACGTGTAATGC-3′ antisense 5′-GAGGATCTTTGCTTTGATGC-3′. The PCR program was 40 cycles of 95°C/15 s, 57.5°C/30 s, and 72°C/1 min, preceded by denaturation at 95°C/3 min. The relative difference in expression of Drosha was calculated by the ΔΔCt method using Smn2 as a reference gene.

Poly(A) length assay

This assay was performed according to Murray and Schoenberg (2008). We used the oligo(dT) adapter 5′-GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTTT in combination with the mRNA-specific primer 5′-CCTTTATCGCTGCCCTTTAT.

Klonlanması Ksenop Drosha

To clone full-length Ksenop Drosha, a 5′ and 3′ RACE protocol was applied using primers in a region that was found conserved from fish to mammals. The forward primer taggccacaatcagagaat and the reverse primer ccatctgggggaagttatat were used for the anchored PCR on cDNA isolated from X. laevis poly(A) RNA (Zhang and Frohman, 1997). The ends of the Drosha cDNA were subsequently cloned using 5′ and 3′ RACE protocols as published (Zhang and Frohman, 1997). The resulting fragments were assembled and verified by sequencing.

Western blotting

The same numbers of Ksenop oocytes and eggs from two different frogs were manually defolliculated and homogenized, and the insoluble fraction was removed by centrifugation. The soluble fraction was denatured by addition of 2× Laemmli buffer and heating to 95°C for 5 min (Laemmli, 1970). The equivalent of 1.5 oocytes or eggs was run on 6% SDS polyacrylamide gels, and proteins were blotted to nitrocellulose and detected as follows: detection of Drosha was achieved with a human- and mouse-specific antibody that cross-reacts with Ksenop Drosha (D28B1 rabbit monoclonal antibody 3364 Cell Signaling Technology, Beverly, MA). To control for equal loading, the same blot was also incubated with α-tubulin antibody (Sigma-Aldrich, St. Louis, MO). As secondary, an anti-rabbit AP antibody (31340 Pierce) was used. Myc-tagged Drosha was detected with the anti-myc monoclonal antibody 9E10 and a labeled, secondary anti-mouse antibody.


Müzakirə

Ensuring the quality of ASQ reactions

Genomic DNA preparation

The quality and amount of DNA template are critical factors in determining the specificity of ASQ reaction and genotype scoring. Although we have used NaOH-treated crude DNA preparations without any complication, there are differences in the quality of crude preparations, especially when using end-point analysis. To control the quality of DNA preparations, it is important to adhere to the same treatment regimen for each treatment. After NaOH treatment, the tissue needs to be vortexed or vigorously flicked to make each sample a homogeneous solution. Once the tissue has been thoroughly homogenized (although still cloudy), Tris buffer (pH 8) has to be added to the samples to neutralize NaOH and prevent extensive nicking of genomic DNA.

Assessing the quality of each ASQ assay

To assess the quality of DNA templates in a reaction (96-well plate), a dilution series of genomic DNA of known genotype is used (see Supplementary Figs. S4–S9 for standard curves for each locus). The spurious amplification can be detected by comparing the amplification of the dilution series against the amplification of NTCs. Any amplifications occurring beyond the mean Ct or below the mean fluorescence value of NTCs should be considered nonspecific amplification. The dilution series provides the relative amount of DNA at which specific amplification terminates and spurious amplification arises. The dilution series is useful because DNA is generally used without accurate quantification in crude preparations. Samples may show nonspecific reactions for various reasons, including evaporation, poor DNA quality, low DNA quantity, or a high concentration of PCR inhibitors such as excess salts, polysaccharides, hemoglobin, immunoglobulin G, and proteinases. 39,40 Those samples with spurious amplification should be discarded from genotype calling.

While we have successfully used crude preparation of approximately 3 ng of genomic DNA, the lowest amount of DNA template that can be used would vary depending on the quality of DNA preparation and the specificity of the reaction. We anticipate that lower quantities of DNA template would work if purified DNA samples are used. We did not test purified DNA templates because the purpose of developing the ASQ system was to perform a rapid and accurate genotyping in the most versatile and convenient way.

Analyzing assays accurately

Choosing between a Ct value and end-point reading method

With ASQ, genotype scoring can be accomplished with either threshold cycle (Ct) or end-point fluorescence reading. Beginning with the Ct value method is easier to optimize the assay conditions. In the Ct value method, fluorescence values are read in each cycle of the second tier amplification (Table 3). Because the increasing fluorescence values are acquired at each cycle, we can determine the cycle at which spurious reaction arises and the sensitivity of the reaction using the NTCs and a dilution series. A total of 40 cycles in the second-tier amplification were used during this optimization process, and a decreased number of cycles can be used once the assay is optimized. The end-point reading method can shorten the reaction time because the reading is conducted only one time after a completion of the reaction. After optimization, the end-point reading in routine ASQ applications would save time and can be done on a standard thermal cycler.

Other applications and considerations

Combining ASQ in nested PCR

It is often necessary to process samples for both RNA extraction and DNA genotyping. If the model system is a larger animal or cell culture, different portions of the sample can be allotted for either RNA or DNA preparation. In smaller animal models such as larval zebrafish and fruit flies, the amount of tissue is often limited and the reagents used to neutralize RNase can strongly inhibit PCR. In such case, we have performed ASQ genotyping using a nested PCR approach. We used a pair of “outer” primers for the first PCR that generates a bigger amplicon flanking allele-specific primer/reverse primer binding ranges. In this application, 1 μl (or any small volume) of each sample prepared for RNA extraction was diluted at 1:25 in 24 μl of PCR-grade water. The first PCR was performed with this DNA sample and outer primers. Subsequently, the first PCR product was diluted at 1:100 and the diluted PCR product was used as DNA source for ASQ genotyping. The nested PCR successfully lowers the amount of PCR inhibitors such as guanidine thiocyanate in RNA extraction buffer 41 while increasing the amount of DNA template for ASQ. In this application, lower Ct values were observed compared with the genomic DNA preparation, implying that the products for the first PCR contained a higher concentration of DNA than genome DNA.

Size of the amplicons

The size of the amplicon generated between an allele-specific primer and reverse primer varied widely ranging from 165 bp (nr3c1) to 365 bp (nod2) without affecting the accuracy of genotype scoring (Supplementary Table S2). This dynamic range should assist in designing a reverse primer with a proper annealing temperature in AT or GC-rich regions.

Dealing with SNPs and 1 bp deletion or insertion

Designing a pair of ASPs (wild-type vs. mutant) at an SNP site is more challenging than designing an assay for indel sites. Because of the mechanism of ASQ, the locus of ASPs is fixed at the site of the SNP. The guidelines, described in the Materials and Methods section such as modifying the length of ASPs and changing the directionality of ASPs and a reverse primer, should be generally sufficient to produce a successful assay. However, if correct genotype calling fails after exhausting these basic options, an alternative primer designing can be applied. This guideline exploits the fact that one mismatch at the 3′ end of the primer might not be sufficient to prevent an nonspecific extension, whereas two consecutive mismatches at the 3′ end of the primer increase the possibility of preventing an extension. 21,42 The penultimate nucleotide in the ASPs can be intentionally made to be the same nucleotide on the binding strand instead of being complementary. This way, the ASPs (wild-type vs. mutant) will have two mismatches at the 3′-end on the opposite allele. When the ASPs designed with the penultimate-site mismatch are tested, it is strongly recommended to perform gradient PCR to determine the most effective annealing temperature during the first-tier PCR. We applied this method to the il-6 locus and could acquire stronger signals and better clusters (Supplementary Fig. S3 Table 1).


Materiallar və metodlar

Ethics statement

This study was performed according to the Helsinki II Declaration and was approved by the medical ethics committee of Jiangsu Cancer Hospital. Sixty clinical blood samples were obtained from breast cancer patients at Jiangsu Cancer Hospital. Written informed consent was obtained from all subjects.

Primer design and synthesis

All primers were designed using the Primer Premier 5.0 program. For point mutation detection, an allele-specific primer matching the wild-type sequence and a common primer matching both wild-type and mutant sequences were designed. In addition, three blocked primers were synthesized by blocking the 3'-terminal nucleotide with 3'-Pi or-Amino C6(-NH2), or replacing it with ddCTP. The blocked primers have same sequences as the allele-specific primer. All primers were synthesized commercially by BioSune Biotechnology Co., Ltd. (Shanghai, China).

Construction of various mutants

The wild-type template was obtained by constructing a recombinant pMD18-T plasmid (TaKaRa, Dalian China) containing a fragment of human genomic DNA. To evaluate the applicability of the proofreading PCR method, a series of mutant plasmids containing single-base mutations (including point mutations, deletions and insertions) at different positions were constructed using site-directed mutagenesis technology. All plasmids containing the wild-type fragment and various mutations were used as the templates after purification and confirmation via direct sequencing.

Detection of various mutants

Both the wild-type and mutant templates (plasmids) were amplified using an allele-specific 3'-ddC-blocked forward primer and an unblocked reverse primer. The PCR amplifications were performed in a total volume of 20 μL with 2 μL of (10×) Taq PCR buffer, 0.2 mM deoxynucleotide-triphosphate (dNTPs), 1 ng of template, 0.15 units (U) of KOD FX DNA polymerase (TOYOBO, Osaka, Japan), 1 U of Taq DNA polymerase (TaKaRa, Dalian, China) and 0.3 μM each of reverse primer and 3'-ddC-blocked forward primer. The reactions were carried out under cycling conditions of pre-denaturation at 94°C for 2 min, followed by 30 cycles of denaturation at 94°C for 20 s, annealing at 62.2°C for 20 s and extension at 72°C for 25 s (the annealing temperature used for the amplification of Mu*8 was 62.9°C). The PCR products were visualized via 1.5% agarose gel electrophoresis.

Confirmation test using human cancer cell lines and clinical samples

To further evaluate the detection efficiency of the modified PR-PCR in realistic samples, two breast cancer cell lines HCC1937(ATCC#CRL-2336) and MCF-7(ATCC#HTB-22), purchased from the Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences (Shanghai, China) and 60 clinical blood samples obtained from breast cancer patients were prepared. HCC1937 that carries a homozygous TP53 mutation in codon 306 (p.R306X, c.916C>T) was used as the mutant sample, while MCF-7 that does not carry this mutation was used as the wild-type sample [25]. Both cell lines were cultured following ATCC protocols.

Genomic DNA (gDNA) was extracted from both cell lines using the MiniBEST Universal Genomic DNA Extraction Kit (TaKaRa, Dalian, China) following the manufacturer’s instructions. For the 60 blood samples, gDNA was extracted using the TIANamp Blood DNA Kit (TIANGEN, Beijing, China) according to the manufacturer’s instructions. The extracted gDNA was eluted into 70 μL of (1×) TE buffer (pH 8.0) and then quantified using a Nanodrop-1000 Spectrophotometer (Thermo Fisher Scientific, Wilmington, DE).

For the clinical samples, the modified PR-PCR was performed in a total volume of 25 μL reaction mixture including 20 ng of gDNA, 3.75 μL of (5×) PrimeSTAR buffer, 1.25 μL of (5×) Taq PCR buffer, 0.2 mM dNTPs, 0.2 U of PrimeSTAR HS DNA polymerase, 0.7 U of Taq DNA polymerase, 1 μL of DMSO and 0.3 μM each of reverse primer, fusion-blocked forward primer and adaptor. The reactions were carried out under cycling conditions of pre-denaturation at 94°C for 2 min 40 cycles of denaturation at 98°C for 10 s, annealing at 59°C for 20 s and extension at 72°C for 18 s. The PCR products were visualized via 1.5% agarose gel electrophoresis.

To confirm the results obtained from the modified PR-PCR, a 430 bp fragment of the TP53 gene containing the P72R mutation was amplified via routine PCR (S2 Table). The PCR products were purified and sent to BioSune Biotechnology Co., Ltd. for sequencing.

Detection of rifampin-resistant mutations in Mycobacterium tuberculosis (TB)

Three rifampin-resistant (S479, S643, and S748) and three rifampin-sensitive (N15, N7, and N9) TB strains were isolated from the Huzhou Center for Disease Control and Prevention. Rifampin resistance and susceptibility of TB strains was determined using the proportional method on Löwenstein-Jensen medium with serial dilutions of rifampin, in accordance with the Deutsches Institut für Normung (DIN) guidelines (DIN 58943–8).

Two most common rifampin-resistant mutations, H526Y (CAC>TAC) and S531L (TCG>TTG) [26] in the rpoB gene of TB were detected using the modified PR-PCR. All reactions were performed in a total volume of 20 μL containing a mixture of 2 μL of (10×) Taq PCR buffer, 0.2 mM dNTPs, 1 U of Taq DNA polymerase, 0.15 U of PrimeSTAR HS DNA polymerase, 5 ng of gDNA (equal to approximately 1×10 6 copies of the TB genome) and 0.3 μM each of 3'-blocked forward primer and common reverse primer. The PCR cycling conditions consisted of pre-denaturation at 95°C for 1 min, followed by 35 cycles of denaturation at 95°C for 15 s, annealing at 59°C for 15 s and extension at 72°C for 15 s.

To confirm the results obtained from the modified PR-PCR, a 493 bp fragment of the rpoB gene encompassing the two mutation sites from six TB strains was sequenced using the 454 GS-FLX system (Roche Diagnostics Corporation). Approximately 1×10 9 molecules of the final normalized, adaptor and sequencing key-ligated 493 bp amplicon were prepared and sequenced according to the published Roche 454 GS FLX Titanium protocols.


Təşəkkürlər

We thank Victoria Reckamp for expert assistance with the preparation of this paper. This work was supported by National Institutes of Health Grants AG00425 (to J.O.H.), K01 DK063051 (to J.M.H.), and Diabetes Research and Training Grant P60 DK20579-28. P.G.-R. was supported by an American Diabetes Association Mentor-Based Postdoctoral Fellowship. C.H. was initially supported by an American Diabetes Association Mentor-Based Postdoctoral Fellowship and subsequently by National Institutes of Health Individual National Research Service Award 1F32DK076410.


MÜZAKİRƏ

Finding genes in large chromosomal regions has been approached in three ways: exon trapping, DNA sequencing analysis, and direct hybridization selection. Exon trapping works when the gene in question contains splicing sites that are efficiently recognized by the host cell (6–8). But it fails when introns are absent or the intron–exon borders are not recognized and exon trapping yields a background of false candidates derived from cryptic splice sites. DNA sequencing is effective when the gene in question has homology to a known expressed sequence. Even without homology, computational methods for predicting genes also have promise (4). But DNA sequencing on a massive scale is still costly. Direct hybridization selection (1) has also found use, but it diminishes in usefulness with rare messages and suffers from the vagaries of physical selection methods and background problems with repetitive sequences. We have described an additional approach to this problem: an effective protocol for selecting cDNA fragments that are homologous at one of their ends to one of the ends from a collection of genomic fragments. This method should work whenever a cDNA population is available that contains transcripts from the gene in question.

A protocol (end ligation coincident sequence cloning, EL-CSC) similar to ours, has been presented by Brookes və b. (14). Like ours, their protocol is based upon heteroduplex formation between DNA fragments made from two populations, and the use of ligation (with what they call “capture oligonucleotides”) to distinguish heteroduplex from homoduplex. Unlike our procedure, their method requires heteroduplex formation at both ends between cDNA and genomic fragments, because both ends of the heteroduplex must be ligated. Thus, cloning of cDNA fragments that span introns is much less likely. In our procedure, we use a selection adaptor that allows us to generate an RNA intermediate, and so we can isolate heteroduplexes that have formed at only one end. Moreover, EL-CSC uses physical trapping through biotin–avidin complex formation to enrich for products. We have experienced difficulty with protocols incorporating such methods and have avoided them in RICH. The report of Brookes və b. (14) does not contain sufficient information to enable us to make quantitative comparisons of our methods nor have we found their procedure used in the published literature.

Although the yield of c-MYC fragments in the RICH products was very satisfactory, the yield of PTEN products was less so. An additional prescreening of RICH products from PTEN was needed: namely, the verification of the adaptors and the Sau3AI sites that should be present upon proper priming and ligation. We believe that this is due to the reduced level of expression of the PTEN gene compared with c-MYC. Moreover, an analysis of our products from the PTEN BAC revealed a higher proportion of repeat-containing sequences than were found for c-MYC, presumably for the same reason.

Not all fragments from the same cDNA will have the same yield. For example, the 880-bp fragment from c-MYC was not obtained as a RICH product. We speculate this may be due to the difficulty of obtaining long transcripts from the SP6 polymerase. Also, we did not clone the 520-bp fragment of PTEN that was seen upon Southern blotting to be present in reduced amount. Most strikingly, we do not observe very short fragments in the RICH products. Possibly, this deficit is partially due to the slower kinetics of hybridization of shorter fragments (15). Gel fractionation before cloning might overcome some of these problems of underrepresentation. Alternatively, these limitations can be overcome by using different restriction endonucleases during the protocol.

We have introduced one variation in our method: amplifying genomic DNA fragments before use. This step was incorporated for two reasons. (i) If genomic fragments are amplified and not cleaved, it should be unnecessary to partially fill-in the ends of restriction endonuclease cleaved cDNA, because the selection adaptor cannot be ligated to PCR-amplified genomic DNA. Thus, with this variation, any restriction endonuclease can be chosen, if used both for cDNA cleavage and amplification of genomic fragments, overcoming limitations in the discovery of cDNAs that might result from the use of Sau3AI discussed above. (ii) With genomic amplification the user can initiate the search for transcripts with very small amounts of genomic DNA. In fact, we have performed RICH starting from small amounts of gel-purified BAC DNA. It may be possible to extend this method to gel-purified yeast artificial chromosome DNAs.

We cannot obtain the 3′ or 5′ ends of cDNA transcripts with RICH because only cDNA fragments with restriction endonuclease cleavage sites at both ends can be selectively amplified. However, RICH can be used in reverse (rapid isolation of genes by hybridization to transcripts, RIGHT) to identify genomic clones with homology to cDNAs. The directional modifications of genomic fragments and cDNAs used in RICH can be essentially reversed, rendering genomic fragments that form heteroduplex with cDNA the only selectable RIGHT products. When unamplified cDNAs are used, the RIGHT protocol should yield the 3′ and 5′ ends of a transcription unit. In addition, RIGHT might facilitate the confirmation of cDNAs found by RICH and aid in the determination of intron-exon boundaries.