Məlumat

36: Bile Esculin - Biologiya

36: Bile Esculin - Biologiya


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Öyrənmə Məqsədləri

  • Orqanizmin yüksək öd konsentrasiyasında böyümək və şəkər eskulindən istifadə etmək qabiliyyətini müəyyənləşdirin

ÖD ESCULIN

Bile esculin agar maili formada gəlir. Birdə 2 testdir ---40% öd müqaviməti VƏ şəkər eskulinin istifadəsi. Öd xüsusilə bu konsentrasiyada çox maneə törədən bir kimyəvi maddədir. Əgər bakteriya böyüyərsə, növbəti sual onun eskulindən istifadə edib-etməməsidir.

Bakteriyanız öd varlığında inkişaf edə bilmirsə, eskulin reaksiyası eskulin şəkər diskindən istifadə edərək fərqli bir şəkildə əldə edilməlidir.

LAZIM MATERİALLAR

  • 1 öd esculin maili hər naməlum

PROSEDUR

  1. Naməlumunuzdan istifadə edərək, inokulumu maili yuxarıya çəkin.
  2. Ortanı 25ºC və ya 37ºC-də inkubasiya edin.

TƏFSİR

  1. Maili böyümə = 40% safra müqaviməti
  2. Eskulin şəkərinin istifadəsi = maili qara qəhvəni (1/2-dən çox maili və ya bütün agar) rəngə çevirir

SUALLAR

  1. Safra eskulində böyümənin olması __________ deməkdir.
  2. Esculin nədir?

25 Hidroksixolesterin

Henriikka Kentala,. Vesa M. Olkkonen, Hüceyrə və Molekulyar Biologiyanın Beynəlxalq İcmalında, 2016

1.3 ORP-lərin lipid ligandları

OSBP, məməlilərin ORP-lərinin arxetipi, ORD lipid bağlayan cibində 25-hidroksixolesterolu (25OHC) bağlayır. Kd 10 nM-dən və daha aşağı yaxınlığa malik digər oksisterol növləri (Taylor et al., 1984 Dawson et al., 1989 Wang et al., 2002). Əhəmiyyətli olan, OSBP də xolesterolu a ilə bağlayır Kd 173 nM (Wang et al., 2005, 2008). ORP I subfamilyasında OSBP-nin yaxın homoloqu ORP4L, oxşar şəkildə 25OHC-ni bir Kd 10 nM (Wang et al., 2002) və ORP4S variantı ilə aparılan təcrübələr ORP4-ün də xolesterolu daha aşağı yaxınlıqda bağladığını irəli sürdü (Wyles et al., 2007). ORP II alt ailəsində ORP1L 25OHC-ni bağlayır (Kd 97 nM), 24(S)OHC, 22(R)OHC və 7-ketoxesterin (7KC) nisbətən yüksək yaxınlıqda (Suchanek et al., 2007 Vihervaara et al., 2011), ORP2 isə yüksək yaxınlıq göstərir (Kd 22(R)OHC üçün 14 nM (Hynynen et al., 2009), lakin yalnız aşağı yaxınlıq (Kd 3.9 μM) 25OHC üçün (Suchanek et al., 2007), hətta yaxından əlaqəli ailə üzvlərinin də liqand spesifikliyində fərqli fərqlər göstərə biləcəyini nümayiş etdirir. OSBP və ORP4L kimi, bir neçə digər ORP xolesterolu bağlamaq üçün təklif olunur (Hynnen və digərləri, 2009 Ngo və Ridgway, 2009 Vihervaara et al., 2011 Nissilä et al., 2012 Liu and Ridgway, 2014) Əslində, ORP-nin uğursuzluğu tövsiyə olunur. oksisterolları bağladı, lakin xolesterolu bağladı in vitro (Ngo və Ridgway, 2009) və lipozomlardan xolestatrienol və PI4P çıxara bilir (Liu və Ridgway, 2014). Eynilə, biz oksisterol bağlanmasını aşkar edə bilmədik in vitro ORP10 (Nissilä et al., 2012) tərəfindən, daha sonra fosfatidilserini (PS) bağlamaq təklif edildi (Maeda və digərləri, 2013). Fotoçapraz bağlana bilən radioetiketli xolesterol və 25OHC istifadə edən bir araşdırmada biz cəmi 10 insan ORP üçün bu sterollardan biri və ya hər ikisi üçün müsbət çarpaz əlaqə siqnalı müşahidə etdik (Suchanek et al., 2007). Bununla belə, bütün müşahidə olunan siqnalların ORD liqand boşluğuna etiketlənmiş sterol törəmələrinin daxil edilməsini əks etdirib- əks etdirməməsi bir qədər aydın olaraq qaldı. Onlardan bəziləri membranla əlaqəli zülalların səthi ilə çarpaz əlaqə nəticəsində yarana bilər.

Maya Oş zülalları üzərində aparılan struktur tədqiqatlar lipidlərlə ORP ligandlaşması haqqında biliklərimizi nəzərəçarpacaq dərəcədə inkişaf etdirdi. Im et al tərəfindən hesabat. (2005) beş müxtəlif sterol: erqosterol, xolesterin və 7KC, 20 və 25OHC ilə "qısa" maya ORP Osh4p (həmçinin Kes1p kimi tanınır) yüksək rezolyusiyaya malik strukturunu ortaya qoydu. Əhəmiyyətli olan de Saint-Jean et al. (2011) ORD liqand boşluğuna daxil edilmiş PI4P ilə Osh4p quruluşunu təyin etdi və bağlı sterolun asanlıqla PI4P ilə mübadilə edildiyini göstərdi.

Bağlanmış PI4P ilə Osh3p ORD-nin strukturu (Tong və digərləri, 2013) bu zülalın ligand boşluğunun böyük sterol molekullarını yerləşdirmək üçün çox dar göründüyünü ortaya qoydu və bu, bütün ORP-lərin sterolları bağlamaq qabiliyyətinə malik olmadığını göstərir. Müəlliflər qeyd etdilər ki, ligand boşluğunun girişində inozitol-4-fosfat bağlayan yarığı əhatə edən amin turşusu qalıqları, “OSBP barmaq izi” ardıcıllığının qalıqları da daxil olmaqla, bütün ORP-lər arasında yüksək dərəcədə qorunur (Şəkil 2 (B)). De Saint-Jean və digərlərinin oxşar tapıntıları ilə birlikdə. (2011) , bu müşahidə PI4P bağlanmasının bütün ORP-lərin birləşdirici xüsusiyyəti ola biləcəyini və ailə üzvlərinin yalnız bir hissəsinin əlavə olaraq sterolları bağlaya biləcəyi ehtimalını ortaya çıxardı. ORP liqand spesifikliyində yeni bir cəhət Maeda və digərləri tərəfindən aşkar edilmişdir. (2013), Osh6p və Osh7p mayasının PS-ni xüsusi olaraq bağladığını nümayiş etdirdi. Müəlliflər həmçinin Osh6p-ni kristallaşdırdılar və PS-ni ORD liqand boşluğuna modelləşdirdilər. Baş qrup və doymamışlar sn-2 yağlı asil zənciri boşluğun girişinə doğru yönəldilmişdir, doymuş sn-1 yağlı asil zənciri cibin altına doğru daxil edilmişdir. Osh6p membranlardan hər hansı bir erqosterol varsa, çox az çıxarılır və bu, Osh3p kimi, sterolları bağlaya bilmədiyini göstərir, beləliklə, ehtimal ki, ORP-lərin yeni, "qliserofosfolipid bağlayan alt qrupuna" aiddir. Maya və məməlilərin ORP-ləri üçün müəyyən edilmiş ORD liqandları Cədvəl 1-də ümumiləşdirilmişdir.

Cədvəl 1. İnsan və ORD-ları üçün müəyyən edilmiş liqandlar S. cerevisiae Struktur təhlilləri ilə ORP və ya in vitro bağlama/nəqliyyat analizləri.

məməliLiqandlarİstinadlar
OSBP25OHC və digər oksisterollar, xolesterin, PI4P Taylor və başqaları. (1984) Dawson et al. (1989) Ridgway et al. (1992) Wang et al. (2005) Wang et al. (2008) Mesmin et al. (2013)
ORP4/OSBP225OHC, 7KC 20OHC, 22(R)OHC, 22(S)OHC, 7OHC, xolesterin Wang et al. (2002) Wyles et al. (2007)
ORP124(S)OHC, 22(R)OHC, 25OHC, 7KC, xolesterin Suchanek və b. (2007) Yan et al. (2007) Vihervaara et al. (2011)
ORP222(R)OHC, 7KC, 25OHC, xolesterin Suchanek və başqaları. (2007) Hynynen et al. (2009)
ORP3?
ORP6?
ORP7?
ORP5PS, dehidroerqosterol, xolesterol? Maeda və başqaları. (2013) Du et al. (2011)
ORP8Xolesterol, 25OHC? Zhou və başqaları. (2011) Yan et al. (2008)
ORP9Xolesterol, PI4P Nqo və Ridqvey (2009) Liu və Ridqvey (2014)
ORP10PS, xolesterol? Maeda və başqaları. (2013) Nissilä et al. (2012)
ORP11?
S. cerevisiae
Osh1pXolesterol? Schulz və başqaları. (2009)
Osh2pXolesterol Schulz və başqaları. (2009)
Osh3pPI4P, xolesterol? Tong və başqaları. (2013)
Osh4pErqosterol, xolesterin, 7OHC, 20OHC, 25OHC, dehidroerqosterol, PI4P, PI(4,5)P2?, PS? Im et al. (2005) Raychaudhuri et al. (2006) de Saint-Jean et al. (2011)
Osh5pXolesterol Schulz və başqaları. (2009)
Osh6pPS Maeda və başqaları. (2013)
Osh7pPS Maeda və başqaları. (2013)

Safra atreziyasında və digər xolestatik pozğunluqlarda antikolestatik terapevtik hədəf kimi safra turşusu daşıyıcısının inhibisyonu

Öd yollarının atreziyası körpələrdə özünü göstərən və müdaxilə edilmədikdə sürətlə ölümlə nəticələnən nadir xolestatik qaraciyər xəstəliyidir. Öd yollarının tıxanması və ya məhv olması nəticəsində öd turşuları yığılır və iltihabı, fibrozu və xəstəliyin gedişatını artırır. Standart qayğı, Kasai portoenterostomiyası (KPE), adətən diaqnozdan qısa müddət sonra həyata keçirilir (hazırda

2 aylıq) və öd axını bərpa etmək və xolestazı aradan qaldırmaq məqsədi daşıyır. Buna baxmayaraq, əksər xəstələrdə KPE-dən sonra öd turşularının yığılması nəticəsində qaraciyər zədələnməsi davam edir, çünki KPE-dən sonra sağ qalmağı artıra bilən effektiv terapevtiklər məlum deyil. Öd turşularının enterohepatik dövranının kəsilməsi yolu ilə xolestazın yaxşılaşdırılması qaraciyərdə öd turşusunun tutulmasını birbaşa zəiflədə və erkən orqan çatışmazlığı riskini azalda bilər. Öd turşularına xas olan toksikliklərin qarşısını almaq üçün öd turşularının qaraciyərdaxili yığılmasının birbaşa həlli öd yollarının atreziyası üçün cəlbedici və məqbul terapevtik hədəf təmin edir. Bu icmal ASBT (apikal natrium-öd turşusu daşıyıcısı, kodlaşdırılmış) kimi tanınan yeganə ileal öd turşusu daşıyıcısının (IBAT) inhibe edilməsinin yeni terapevtik konsepsiyasını araşdırır. SLC10A2), KPE-dən sonra qaraciyər öd turşusunun konsentrasiyasını azaltmaq üçün bir vasitə kimi. Öd turşularının xolestatik qaraciyərə qaytarılmasını azaltmaqla, IBAT inhibitorları öd turşusu yığılmasının hepatotoksikliyi və xolangiopatiya ilə əlaqəli qaraciyər zədələnməsini potensial olaraq azalda və ya gecikdirə bilər. Uşaqlarda xolestatik qaraciyər xəstəliklərinin, maralixibat və odevixibatın müalicəsi üçün inkişafda olan 2 IBAT inhibitorunun klinik proqramları vurğulanır.

Bu, abunə məzmununun, qurumunuz vasitəsilə girişin önizləməsidir.


Giriş

Öd turşuları qaraciyərdə istehsal olunan və qlisin və ya taurinlə birləşmiş ilkin öd turşuları kimi öddə ifraz olunan bioloji əhəmiyyətli xolesterol törəmələridir (Chiang, 2009). İstehsal edilən əsas ilkin öd turşuları insanlarda xolik turşusu (CA) və chenodeoxycholic acid (CDCA), siçanlarda isə CA və murikol turşusudur (MCA) (Hofmann, 1999 Russell, 2003). Bu ilkin öd turşularının konjuge formaları öd kanalı vasitəsilə onikibarmaq bağırsağa buraxılır, burada onlar qida lipidlərinin emulsifikasiyası və udulması üçün yuyucu vasitə kimi çıxış edirlər (Hofmann, 2009). Həzm funksiyalarından əlavə, öd turşuları həm də ev sahibi metabolizminin hormon kimi tənzimləyiciləri (Kuipers və digərləri, 2014), həmçinin antimikroblar (Begley və digərləri, 2005) kimi çıxış edirlər. Onların potensialına bağırsaq tranziti zamanı bir neçə mikrob transformasiyası təsir edir.

Nazik bağırsaqda ilkin öd turşuları öd turşusu hidrolazları ilə dekonjuqasiya olunur, bunlar müxtəlif növ bağırsaq bakteriyası taksonları ilə ifadə edilir. Bakteroidlər (Narushima et al., 2006), bağırsaq mikrobiotasında dominant qrup. İlkin öd turşularının təxminən 95% -i nazik bağırsaqda reabsorbsiya edilir və enterohepatik dövriyyə vasitəsilə təkrar emal olunur (Russell, 2003 Ridlon et al., 2005 Hofmann, 2009). Enterohepatik dövriyyədən qaçan qalan 5% isə yoğun bağırsaqda əlavə mikrobial transformasiyalara məruz qalır (Ridlon et al., 2005, 2016). Ən mühüm öd turşusu transformasiyalarından biri deoksixolik turşu (DCA) və litoxolik turşu (LCA) daxil olmaqla, ikincil öd turşularını yaradan 7º-dehidroksilləşmədir. Bu çox addımlı biokimyəvi yol, kodlanmışdır bai (𠇋ile acid induksiable”) gen operonu, bakteriya növlərinin dar filogenetik qrupu ilə məhdudlaşır. Clostridium klaster XIV və növlərdə ən geniş şəkildə tədqiq edilmişdir Clostridium scindensClostridium hylemonae (Ridlon və başqaları, 2005, 2016).

Ev sahibi tərəfindən istehsal olunan birləşmiş ilkin öd turşularının DCA və LCA-ya çevrilməsi mikrobların növlərarası birgə metabolizma nümunəsidir. 7ºB1-dehidroksilləşmə bakteriyaları qlisin və ya taurinlə birləşmiş öd turşularının dekonjuqasiyası üçün digər mikrob növlərindən asılıdır, çünki onlar yalnız konyuqasiya olunmamış öd turşularını metabolizə edə bilirlər. Bu səbəbdən öd turşusu 7-dehidroksilləşmə insan 7-dehidroksilləşdirici növlər tərəfindən həyata keçirilir. C. scindensC. hylemonae öd turşusu dekonjugasiya edən orqanizmlər olmadıqda mono-kolonizasiya olunmuş heyvanlarda baş verə bilməz (Narushima et al., 1999).

İkincil öd turşuları bağırsaq infeksiyasına qarşı müqavimətdə əsas rol oynayır (Begley et al., 2005). Ən yaxşı öyrənilmiş nümunədir Clostridium difficile infeksiya (CDI), nozokomial, antibiotik terapiyası ilə əlaqəli diareya infeksiyası (Rupnik et al., 2009). Sağlam bağırsaq mikrobiotası tərəfindən verilən CDI-yə qarşı müqavimət, geniş spektrli antibiotik müalicəsi ilə narahat olduqda (dysbiosis) ləğv edilir (Britton və Young, 2012). Antibiotikin səbəb olduğu disbioz kolonda ikincil öd turşusu biosintezinin ləğvi ilə əlaqələndirilir (Antunes və digərləri, 2011 Theriot et al., 2016, 2014).

Öd turşularının tənzimlənməsi yaxşı sübut edilmişdir C. difficile endosporun cücərməsi və böyüməsi, həmçinin vegetativ böyümə (Wilson et al., 1982 Wilson, 1983). Cücərmə reseptorları isə C. difficile yalnız qismən müəyyən edilir (Francis et al., 2013a Fimlaid et al., 2015), ilkin öd turşuları tauroxolik turşu (TCA) və xolik turşusu, eləcə də ikincili öd turşusu DCA sübut olunmuş cücərtilərdir. C. difficile sporlar (Sorg və Sonenshein, 2008). Bundan əlavə, chenodeoxycholic acid (CDCA), eləcə də murikol turşusunun (MCA) alfa və beta stereoizomerlərinin inhibə etdiyi məlumdur. C. difficile cücərmə (Sorg və Sonenshein, 2010 Francis et al., 2013b). Bundan əlavə, DCA, eləcə də LCA, ursodeoksixol turşusu (UDCA) və ω-murixol turşusu (ω-MCA) sporların böyüməsi və vegetativ hüceyrə artımının güclü inhibitorlarıdır. C. difficile (Francis et al., 2013b Weingarden et al., 2015). Beləliklə, öd turşusunu dekonjuqasiya edən və 7-dehidroksilləşdirici mikrob növlərinin kolonizasiya müqavimətinin təmin edilməsində mühüm rol oynadığı fərz edilmişdir. C. difficile. Bu fərziyyəni dəstəkləyən ilkin dəlillər əsasən ondan əldə edilmişdir in vitro eksperimentlər CDI-da mikrob öd turşusunun transformasiyasının vacibliyinə dair birbaşa sübutdur in vivo hələ də azdır. Yalnız bu yaxınlarda, Buffie və həmkarları, metagenomik analizlərdən və antibiotiklərlə müalicə olunan heyvan və xəstə nümunələrinin hesablama modelindən istifadə edərək, antibiotiklərin mövcudluğu arasında güclü müsbət korrelyasiya əldə edə bildilər. C. scindens-əlaqəli takson və CDI müqaviməti və müvəffəqiyyətlə sınaqdan keçirilmiş səbəb əlaqəsi in vivo antibiotiklə müalicə olunan, CDI-yə həssas siçanların inokulyasiyası ilə C. scindens növü ATCC35704 (Buffie et al., 2014).

Bağırsaq mikrobiologiyası C. scindens və əlaqəli növlər hələ də az öyrənilir. Əvvəlki işlərin bir məhdudiyyəti bu idi C. scindens müstəmləkəçilik təcrübələri in vivo endogen öd turşusu 7-dehidroksilləşdirici bakteriyaların aydın olmayan fon səviyyələri olan disbiotik mikrobiotanı ehtiva edən antibiotiklə müalicə olunan heyvanlar tələb olunur. Bu vəziyyət CDI xəstəsindəki şərtləri təqlid etsə də, tədqiqat üçün eksperimental məhdudiyyət ola bilər C. scindens sağlam bağırsaqda fiziologiya.

Əksər eksperimental heyvan tədqiqatları üçün genetik olaraq müəyyən edilmiş inbred siçan suşlarından istifadə etmək standart olsa da, adi heyvan modelləri hələ də ilkin olaraq müəyyən edilmiş və standartlaşdırılmamış mikrob konsorsiumlarını ehtiva edir. Bunlar yüzlərlə və minlərlə müxtəlif əməliyyat taksonomik vahidlərindən ibarətdir və ayrı-ayrı heyvanlar, eləcə də tədqiqat obyektləri arasında əhəmiyyətli dərəcədə dəyişir (Rogers et al., 2014 Ericsson et al., 2015 Hoy et al., 2015). Müasir analitik və hesablama alətləri mikrobiotanın kompleks qarşılıqlı təsirlərinin təhlilini asanlaşdırsa da, mikrobiotanın tərkibini də standartlaşdırmaq imkanı olmadan əsas siqnal və metabolik şəbəkələrin yaradılması çətin məsələdir. Qnotobiotik heyvan modelləri adlanan tam standartlaşdırılmış mikrobiotaya malik eksperimental heyvan modelləri müəyyən edilmiş və azaldılmış mürəkkəbliyi təmin edir. in vivo ev sahibinin mikrobiota qarşılıqlı təsirlərinin dərindən aydınlaşdırılması üçün sistem.

Bu tədqiqatda biz əsas məməlilərin bağırsaqlarını təmsil edən 12 siçan-bağırsaq bakteriya izolatından rasional şəkildə yığılmış “Coligo-siçan mikrobiotası” (Oligo-MM 12) kimi tanınan, yaxınlarda müəyyən edilmiş siçan bağırsaq mikrob konsorsiumundan istifadə etdik. phyla (Brugiroux et al., 2016) üçün platforma kimi in vivo öyrənilməsi C. scindens. Oligo-MM 12 konsorsiumunda birləşdirilmiş bakteriya ştammları bu yaxınlarda ətraflı təsvir edilmişdir və DSMZ anbarında açıq şəkildə mövcuddur (Lagkouvardos et al., 2016). Gnotobiotic Oligo-MM 12 ilə əlaqəli siçanlar (bundan sonra “stabil müəyyən edilmiş orta dərəcədə müxtəlif mikrobiota, siçan 2, ” qısa sDMDMm2 siçanları” adlandırılacaq) ilk olaraq mikrobsuz siçanların mədəni bakteriya kokteyli ilə kolonizasiyası ilə yaradılmışdır. Onlar qnotobiotik şəraitdə 25 nəsildən çox müddət ərzində əhəmiyyətli tərkib sapması olmayan üç müstəqil müəssisədə yetişdirilərək, fizioloji cəhətdən əldə edilmiş və sabit bağırsaq mikrobiotasını saxlayan siçanları təmin etməklə sabit saxlanılıb.

Qnotobiotik sDMDMm2 siçanlarının kolonizasiyası ilə Oligo-MM 12 mikrobiotasını dəyişdirdik. C. scindens ATCC35704 və əldə edilən öd turşusu 7α-dehidroksilləşmə fəaliyyəti və CDI-dan qorunma testi aparıldı in vivo. Bu məqsədlə biz əvvəlcə sDMDMm2 siçanlarının CDI-həssaslığını CDI-nin mikrobsuz və antibiotik müalicəvi siçan modelləri ilə müqayisə etdik və əlaqəli öd turşusu metabolomlarının hərtərəfli kəmiyyət təhlilini apardıq. Daha sonra tətbiqinin təsirlərini təhlil etdik C. scindens əvvəlcədən mövcud olan stabil sDMDMm2 konsorsiumuna. Biz bunu göstəririk C. scindens ATCC35704 ştammı CA və CDCA 7α-dehidroksilləşməni həyata keçirmək üçün funksional olaraq sDMDMm2-yə dəyişdirilə bilər. Bu tapıntı ilə əlaqəli olaraq, C. scindens kolonizasiya xüsusilə gecikmiş bağırsaq böyüməsi C. difficile və müşayiət olunan bağırsaq patologiyası. Yalnız kiçik birbaşa təsirlər C. scindens Tərkibində Oligo-MM 12 model konsorsiumun 12 növü təsbit edildi.


Barrettin Metaplaziyasının Yaranması

Özofagus adenokarsinomalarının hamısı olmasa da, əksəriyyəti Barrettin özofagusundan yaranır, distal yemək borusunu əhatə edən normal skuamöz hüceyrələrin bağırsaq tipli sütunlu hüceyrələrlə əvəz olunduğu vəziyyət 7 . Barrettin özofagusu, bir yetkin hüceyrə növünün digəri ilə əvəzlənməsi, metaplaziya prosesi ilə inkişaf edir. Metaplaziyanın qida borusunda GERD ilə bağlı olduğu düşünülən xroniki toxuma iltihabına 8 qoruyucu cavab olaraq meydana gəldiyi düşünülür. Barrettin metaplaziyası ya tam differensiallaşmış özofagus skuamöz hüceyrələrinin birbaşa bağırsaq tipli sütunlu hüceyrələrə çevrilməsi və ya özofagus kök hüceyrələrinin diferensiasiya modelinin dəyişdirilməsi ilə nəticələnə bilər 8 .


LİPİDLƏRİN MADDƏLƏRİ - PowerPoint PPT təqdimatı

PowerShow.com aparıcı təqdimat/slayd şou paylaşma saytıdır. Tətbiqinizin biznes, necə etməli, təhsil, tibb, məktəb, kilsə, satış, marketinq, onlayn təlim və ya sadəcə əyləncə üçün olmasından asılı olmayaraq, PowerShow.com əla mənbədir. Və ən yaxşısı, onun gözəl xüsusiyyətlərinin əksəriyyəti pulsuz və istifadəsi asandır.

Siz öz slaydlarınızı və təqdimatlarınızı pulsuz olaraq necə təkmilləşdirməyi öyrənə bilmək üçün təsəvvür edə biləcəyiniz hər hansı bir mövzuda nümunə onlayn PowerPoint ppt təqdimatlarını tapmaq və yükləmək üçün PowerShow.com-dan istifadə edə bilərsiniz. Və ya pulsuz olaraq sizə yeni bir şey etməyi öyrədəcək təsvirli və ya animasiya slaydları ilə yüksək keyfiyyətli PowerPoint ppt təqdimatlarını tapmaq və yükləmək üçün istifadə edin. Və ya öz PowerPoint slaydlarınızı yükləmək üçün istifadə edin ki, onları müəllimləriniz, sinifiniz, tələbələriniz, müdirləriniz, işçiləriniz, müştəriləriniz, potensial investorlarınız və ya dünya ilə paylaşasınız.Və ya ondan Facebook dostlarınız və ya Google+ dairələri ilə paylaşa biləcəyiniz 2D və 3D keçidlər, animasiya və seçdiyiniz musiqi ilə həqiqətən gözəl foto slayd şouları yaratmaq üçün istifadə edin. Bu da pulsuzdur!

Kiçik bir ödəniş müqabilində sənayenin ən yaxşı onlayn məxfiliyini əldə edə və ya təqdimatlarınızı və slayd şoularınızı yüksək reytinqlərlə açıq şəkildə təbliğ edə bilərsiniz. Ancaq bundan başqa pulsuzdur. Biz hətta təqdimatlarınızı və slayd şoularınızı bütün orijinal multimedia şöhrəti ilə, o cümlədən animasiya, 2D və 3D keçid effektləri, quraşdırılmış musiqi və ya digər audio və ya hətta slaydlara daxil edilmiş video ilə universal Flash formatına çevirəcəyik. Hamısı pulsuz. PowerShow.com saytındakı təqdimatların və slayd şoularının əksəriyyətinə baxmaq pulsuzdur, bir çoxunu hətta yükləmək pulsuzdur. (Siz insanlara orijinal PowerPoint təqdimatlarınızı və foto slayd şoularınızı ödənişli və ya pulsuz və ya ümumiyyətlə yükləməyə icazə verib-verməməyi seçə bilərsiniz.) Bu gün PowerShow.com-a baxın - PULSUZ. Hər kəs üçün həqiqətən bir şey var!

Təqdimatlar pulsuz. Və ya pulsuz olaraq sizə yeni bir şey etməyi öyrədəcək təsvirli və ya animasiya slaydları ilə yüksək keyfiyyətli PowerPoint ppt təqdimatlarını tapmaq və yükləmək üçün istifadə edin. Və ya öz PowerPoint slaydlarınızı yükləmək üçün istifadə edin ki, onları müəllimləriniz, sinifiniz, tələbələriniz, müdirləriniz, işçiləriniz, müştəriləriniz, potensial investorlarınız və ya dünya ilə paylaşasınız. Və ya ondan Facebook dostlarınız və ya Google+ dairələri ilə paylaşa biləcəyiniz 2D və 3D keçidlər, animasiya və seçdiyiniz musiqi ilə həqiqətən gözəl foto slayd şouları yaratmaq üçün istifadə edin. Bu da pulsuzdur!


Proteinlərin həzminin sistematik icmalı və kiçik peptidlərin çatdırılması üçün yeni strategiyalar

4 Heyvan və Baytarlıq Elmləri Fakültəsi, Şəbüstər Şöbəsi, İslami Azad Universiteti, Şəbistan, İran.

*Müəllif: Tohid Vəhdətpur
Heyvan və Baytarlıq Elmləri Fakültəsi
İslam Azad Universiteti Şəbüstər filialı
Şəbüstər, İran.
Tel: +984114777882
E-poçt: [e-poçt qorunur]

Qəbul tarixi: 16 mart 2016-cı il Qəbul tarixi: 16 may 2016-cı il Nəşr tarixi: 23 may 2016-cı il

Sitat: Vahdatpour S, Mamaghani AP, Goloujeh MS, et al. Proteinlərin həzminin sistematik icmalı və kiçik peptidlərin çatdırılması üçün yeni strategiyalar. Elektron J Biol, 12:3

Mücərrəd

Həzm sistemi müxtəlif proteolitik fermentlər, turşu və digər ifrazatlarla zəngindir, həmçinin lümenin bütün epiteliya səthlərində peptidlərin udulması üçün hüceyrədənkənar və hüceyrədaxili maneələri təmin edən selikli təbəqə ilə örtülmüşdür. Bununla belə, kiçik peptidlər bu maneələrdən keçə və bağırsağın müxtəlif bölgələrindən sorula bilər. Bu peptidlər kiçik, mini və ya kiçik peptidlər kimi bioaktiv peptidlər adlanır. Bioloji aktiv peptidlər, hədəf hüceyrələrdəki xüsusi reseptorlarla qarşılıqlı əlaqə vasitəsilə nəticədə fizioloji funksiyanı modullaşdıran kvazi-hormon və ya dərman kimi fəaliyyətə malik peptidlər kimi müəyyən edilmişdir. Bioaktiv peptidlər antimikrobiyal, antidiyabetik, antitrombotik, antihipertenziv, opioid, immun modulator, mineral bağlayıcı və anti-oksidləşdirici kimi təsnif edilə bilər. Udulan son protein həzm məhsullarının əksəriyyəti fərdi amin turşularıdır, kiçik peptidlərin udulması daha aşağıdır. Peptid daşıyıcısı 1 (PEPT1) ilk növbədə kiçik bağırsaqdan pəhriz dia və tripeptidlərin udulmasına cavabdehdir. Hal-hazırda, farmasevtik tədqiqatlarda kiçik peptidlərə maraq var və inkişaflar klinik sınaqlarda qiymətləndirilir. Bu araşdırmanın məqsədi protein həzmi, kiçik peptidlərin udulması və kiçik peptidlərə vurğu ilə ağızdan çatdırılma gücləndiriciləri ilə bağlı problemləri daha yaxşı başa düşmək üçün mövcud bilikləri ümumiləşdirməkdir.

Açar sözlər

Bariyer həzm peptid PEPT1.

1. Giriş

Demək olar ki, bütün zülallar və bir çox peptidlər həzm sistemində həzm olunur. Buna görə də, hormonlar kimi farmakoloji cəhətdən aktiv zülallar və peptidlər, ağızdan qəbul edilən bioavailability qeyri-adekvat olduğu üçün şifahi olaraq qəbul edilə bilməz və bu, bu birləşmələrin faydalılığını məhdudlaşdıra bilər. Aşağı mədə-bağırsaq bioavailability zəif suda həllolma, mədə-bağırsaq məzmunu daxilində deqradasiya, aşağı membran keçiriciliyi və ya pre-sistemik metabolizm səbəb ola bilər. Zülallarda və digər makromolekullarda olduğu kimi böyük molekulyar çəkiyə görə birləşmələr zəif membran keçirmə qabiliyyətinə malik ola bilər və ya bir çox hidrofilik aşağı molekulyar ağırlıqlı birləşmələrdə olduğu kimi bioloji membranlara bölmək üçün qeyri-kafi lipofilliyə malik ola bilər. Hal-hazırda istifadə olunan çoxsaylı farmakoloji cəhətdən effektiv birləşmələr var ki, onlar inyeksiya edilməyən yollarla qeyri-adekvat bioavailability səbəbindən yeridilməlidir. Absorbsiyanın gücləndirilməsi zəif membran keçirən birləşmələrin inyeksiya edilə bilməyən çatdırılmasına yönəlmiş texnologiyadır. Peptidlərin və zülalların istehlakı adi dərmanlarla müqayisədə bir sıra üstünlüklərə malikdir. Bunlara yüksək aktivlik, yüksək spesifiklik, aşağı toksiklik və minimal qeyri-spesifik və dərman-dərman qarşılıqlı təsirləri daxildir [1]. Biotexnologiyanın inkişafı peptidlərin istehsalı ilə nəticələndi. Ağızdan tətbiqetmə marşrutunun üstünlükləri var, o cümlədən: xəstənin uyğunluğu, tətbiqin asanlığı və istehsalın kifayət qədər aşağı qiyməti. Makromolekulyar dərmanların aşağı oral bioavailability, əsasən, pre-sistem fermentativ deqradasiyadan və bağırsaq membranından zəif nüfuz etməsindən qaynaqlanır. Hazırkı icmal peptidlərin oral qəbulu üçün fizioloji maneələri ümumiləşdirir və bioaktiv peptidlərin oral bioavailliyini yaxşılaşdırmaq üçün yeni əczaçılıq yanaşmalarını təqdim edir.

2. Proteinin həzm edilməsi

2.1 Mədədə həzm

Mədənin mühüm peptik fermenti olan Pepsin 2.0-3.0 pH-da ən aktivdir. Mədə vəziləri çox miqdarda xlorid turşusu ifraz edir. Bu xlorid turşusu bezlərdəki parietal (oksintik) hüceyrələr tərəfindən ifraz olunur və pH orta hesabla 2.0-3.0 arasındadır ki, bu da pepsin fəaliyyəti üçün yüksək əlverişli turşuluq diapazonudur [2]. Pepsin protein kollageni həzm edir. Kollagen hüceyrələrarası birləşdirici toxumaların əsas tərkib hissəsidir, buna görə də həzm fermentlərinin ətlərə nüfuz etməsi və digər ət zülallarını həzm etməsi üçün ilk növbədə kollagen liflərinin həzm olunması lazımdır. Pepsin yalnız zülalın həzm prosesini başlatır, adətən proteini proteazlara, peptonlara və bir neçə polipeptidlərə çevirmək üçün ümumi protein həzminin yalnız 10-20 faizini təmin edir. Zülalların bu parçalanması tək amin turşuları və kiçik kiçik peptidlər yaratmaq üçün son mərhələyə qədər həzm olunan amin turşuları arasındakı peptid əlaqələrində hidroliz nəticəsində baş verir. Udulmuş son protein həzm məhsullarının 95 faizindən çoxu fərdi amin turşularıdır, di- və tripeptidlərin yalnız 5 faizi və digər kiçik peptid molekullarının çox nadir udulması ilə. Bütün peptidlərin və/və ya zülalın udulmuş bu çox az molekulu bəzən ciddi allergik və ya immunoloji pozğunluqlara səbəb ola bilər [3].

2.2 Bağırsaqda həzm

Protein həzminin çoxu nazik bağırsağın başlanğıcında, onikibarmaq bağırsaqda və jejunumda, pankreas sekresiyasından proteolitik fermentlər tərəfindən baş verir. Nazik bağırsaqda zülal qidalarının qismən parçalanma məhsulları əsas proteolitik pankreas fermentlərinin hücumuna məruz qalır: tripsin, kimotripsin, karboksipolipeptidaza və proelastaz. Tripsin və kimotripsin zülal molekullarını kiçik polipeptidlərə parçalayır, karboksipolipeptidaza, daha sonra polipeptidlərin karboksil uclarından fərdi amin turşularını ayırır. Proelastaz, öz növbəsində, elastazaya çevrilir, daha sonra ətləri qismən birləşdirən elastin liflərini həzm edir. Zülalların kiçik faizi mədəaltı vəzi şirələri tərəfindən onların tərkib hissəsi olan amin turşularına qədər həzm olunur [4]. Buna görə də, əksəriyyəti dipeptidlər və tripeptidlər kimi qalır. Bağırsaq lümenindəki zülalların son həzm mərhələsi, əsasən onikibarmaq bağırsaqda və jejunumda olan nazik bağırsağın villisini düzən enterositlər tərəfindən həyata keçirilir. Bu hüceyrələrin hər bir hüceyrənin səthindən çıxan yüzlərlə mikrovillidən ibarət fırça sərhədi var. İki növ peptidaza fermenti vacibdir, aminopolipeptidaza və bir neçə dipeptidaza, qalan daha böyük polipeptidləri tripeptidlərə və dipeptidlərə, bir neçəsini isə amin turşularına bölməyə müvəffəq olur. Dipeptidlər və tripeptidlər olan amin turşuları mikrovillus membranı vasitəsilə asanlıqla enterositlərin daxili hissəsinə daşınır [5].

3. Peptidlərin udulması

Buna görə də, udulmaq üçün peptidlər epiteliya boyunca udulmazdan əvvəl ilk növbədə selikli təbəqə boyunca yayılmalıdır. Sulu sərhəd və ya qarışdırılmamış su təbəqəsi yüksək lipofilik peptidlər üçün məhdudlaşdırıcı amil kimi çıxış edə bilər. Protein bağırsaq epitel hüceyrələrinin monoqatını keçdikdən sonra ya portal venoz sisteminin kapilyarlarına, ya da limfatik lakteaya daxil ola bilər [6]. Lipofilik peptidlərin limfa sistemi tərəfindən udulma ehtimalı daha yüksəkdir [7]. Limfa dövranı qaraciyərdən yan keçir və beləliklə, peptidlərin və zülalların çatdırılmasına cəlbedici yanaşmadır. Limfatik lakteallara sorulma, limfa yavaş sürətlə hərəkət etdiyi üçün bir neçə saat ərzində çox yavaş sistemli çatdırılmanı təmin edir. Baxmayaraq ki, portal venoz sistemə sorulma ilkin qaraciyər keçidindən sonra bir neçə dəqiqə ərzində sistemli dövriyyəyə sürətli çatdırılma ilə nəticələnir.

PEPT1 vasitəçiliyi ilə aktiv udma şifahi olaraq aktiv peptidlərin yüksək bioavailability üçün cavabdehdir, beləliklə 8000-dən çox müxtəlif di- və tripeptidin proton-qoşularaq udulması yüksək tutumlu/aşağı yaxınlıqlı peptid daşıyıcı izoform PEPT1 (SLC15A1) tərəfindən həyata keçirilir. 8]. Nümunələr: sefalosporin və penisilin siniflərinin betalaktam antibiotikləri, ACE inhibitorları, enalapril və fosinoprilin efir dərmanları, bestatin, alafosfalin, amin turşusu ilə birləşdirilmiş antiviral preparatlar (valasiklovir), L-DOPA, həmçinin süni trieptidlər - Sər [9]. PEPT1, D enantiomerlərindən daha çox L amin turşuları olan peptidlərə üstünlük verir. Bir neçə PEPT1 inhibitoru, məsələn, sulfonilürea antidiyabetik dərmanlar, nateglinid, qlibenklamid, tolbutamid, xlorpropamid, sartanlar və ACE inhibitorlarının ester pro-dərmanları müəyyən edilmişdir. Gly-Sar və Val-Ala kimi di-peptidlər də inhibitor potensial nümayiş etdirmişlər, buna görə də süd zülallarının həzm edilməsi nəticəsində yaranan di- və tri-peptidlər PEPT1 vasitəçiliyi ilə dərmanın udulmasını da maneə törədə bilər, bu da zərərçəkmiş dərmanın məruz qalmasının azalmasına səbəb ola bilər (Şəkil 1). .

4. Peptidlərin sorulmasına maneələr

Peptidlərin udulmasına maneələr hüceyrədənkənar və hüceyrədaxili maneələrdir. Peptidlərin ağızdan udulması üçün güclü maneələr mövcuddur. Enjeksiyon peptidləri üçün oral əvəzedicilərin inkişafı peptidlərin istehlakı üçün yüksək prioritet tədqiqatdır [10]. Peptidlərin əksəriyyətinin ağızdan bioavailability bir faizdən azdır. Proteolitik fermentlərin inhibisyonu və sıx birləşmələrin açılması peptidlərin bağırsaqdan parahüceyrəvi daşınmasını artırır [11].

4.1 Hüceyrədənkənar maneələr

Həzm sistemindən peptidlərin udulması fermentativ və nüfuz maneələri ilə qarşılaşır. Həzm sistemində peptidlərin və zülalların hidrolizi lümendə, fırça sərhədində, hüceyrədaxili mayedə və ya enterositlərin sitozolunda baş verə bilər [12]. Zülal həzm olunduqca mədəyə çatır və burada çox turşulu mühitdə mədə şirəsi təsir edir. Mədə şirəsi pepsin adlanan aspartik proteinazlar ailəsini ehtiva edir. Pepsinlər zülalı polipeptidlərin qarışığına həzm edir və onikibarmaq bağırsağa doğru hərəkət edir. Protein onikibarmaq bağırsağa daxil olduqda, pH təxminən 6,0-8,0-a yüksəlir. Təxminən 2.0-dən 8.0-ə qədər olan bu pH dəyişməsi də proteinin izoelektrik nöqtəsi vasitəsilə çökməsinə səbəb ola bilər və sonra asanlıqla yenidən həll olunmaya bilər [4].

Şəkil 1:Amin turşularının və di-tripeptidlərin qana udulması üçün zülalların və peptidlərin həzm edilməsi.

Onikibarmaq bağırsaqda polipeptidlər mədəaltı vəzi proteazları tərəfindən fəaliyyət göstərir. Bu proteazlar tripsin, kimotripsin və elastaz kimi endopeptidazalara və ya karboksipeptidaza A kimi ekzopeptidazalara təsnif edilir. Bu fermentlər polipeptidləri daha kiçik peptidlərə parçalayır. Bu peptidlər daha sonra fırça sərhədindəki proteazlar və enterositlərin sitozolları tərəfindən daha da parçalanır. Dörd və ya daha çox qalığı olan peptidlər üçün proteolitik aktivliyin 90 faizindən çoxu fırça sərhəd membranındadır. Tripeptidlər üçün aktivlik dipeptidlər üçün yüzdə 10-dan 60-a qədərdir, yalnız təxminən 10 faizdir. Lizosomlar və digər hüceyrə orqanelləri də peptid və zülal deqradasiyasının potensial yerləri kimi çıxış edə bilər [13,14]. Fırça sərhədində zülalın N-terminal ucunda fəaliyyət göstərən ekzopeptidazalar var (aminopeptidazlar). Bağırsaqdakı aminpeptidazalara lösin aminpeptidaza və N, A və B amin peptidazaları daxildir. Jejunum və ileumun Payer yamaqlarında aminpeptidaz aktivliyi qonşu yamaqsız bölgələrdəki aktivliyin yalnız 20-30 faizini təşkil edir [14] ]. Fırça sərhəd membran peptidazalarının bağırsaq boyunca paylanması haqqında biliklər müxtəlif bağırsaq bölgələrindən peptidlərin və zülalların üstünlüklü qəbulunu proqnozlaşdırmağa kömək edir [13]. Fərqli fermentlər üçün bu paylanma fərqli ola bildiyindən, oral yolla çatdırılma yeri peptidin amin turşusu ardıcıllığından asılı ola bilər. Bu, fırça sərhəd membran peptidazalarının substrat spesifikliyi ilə bağlıdır. Həmçinin, fırça sərhədi membran peptidazalarının fəaliyyətləri lüminal pH ilə deyil, selikli qişa hüceyrələrinin səthi pH ilə idarə oluna bilər [15]. Buna görə də, karbohidratlara təsir edən bir neçə fermentin bir qlikoprotein olduğu təqdirdə dərmana təsir göstərə biləcəyini başa düşmək lazımdır.

4.2 Hüceyrədaxili maneələr

Peptidlər epiteliyadan iki yolla hərəkət edə bilər. Transcellular marşrut fərdi epitel hüceyrəsinin apikaldan bazolateral səthinə hüceyrədaxili köçürməni əhatə edir. Bu daşınma ya hüceyrənin xüsusi qəbul mexanizmləri vasitəsilə, ya da ardıcıl bölünmə, sulu mühitdən hidrofobik mühitə və sonra yenidən sulu mühitə keçməsi ilə baş verə bilər. Hüceyrələrarası marşrut ardıcıl bölünmə hadisələri ilə lipofilik peptidlərin mənimsənilməsi üçün vacibdir. Karbohidratlar və amin turşuları daşıyıcı vasitəçilik prosesində daşınır. L-amin turşuları aktiv nəqliyyat mexanizmi ilə udulsa da, D-amin turşuları passiv diffuziya ilə udulur. Amin turşuları üçün dörd ayrı nəqliyyat sistemi var və ayrıca bir sistem dipeptidləri və tripeptidləri selikli qişa hüceyrələrinə nəql edir.

Bu daşıyıcı sistemlər hətta amin turşusu və ya peptid tipli dərmanları da daşıya bilir. Hüceyrələrarası marşrut üçün aktiv nəqliyyat mexanizmlərinə Na + birləşdirilmiş qlükoza nəqli və H + birləşdirilmiş dipeptidlərin nəqli daxildir. Bağırsaq fırçası sərhəd veziküllərində qlisilprolin daşınmasının kinetikasına dair tədqiqatlar göstərdi ki, dipeptidlərin nəqli doymuş prosesdir və Michaelis-Menten kinetikasına uyğundur [16]. Dovşan onikibarmaq bağırsağı və jejunum və siçovulların yuxarı nazik bağırsağından hazırlanmış fırça sərhəd membran veziküllərindən (BBMVs) istifadə edərək, fırça sərhəd membranında Na+ və ya H+ asılı daşıyıcı sistem tərəfindən TRH-nin ağızdan udulmasına dair heç bir sübut tapılmadı. Əlbəttə ki, TRH-nin in vivo udulması peptidin parasellüler marşrut boyunca passiv udulması və luminal hidrolizə qarşı müqaviməti ilə izah edilə bilər.

Paracellular marşrut qonşu hüceyrələr arasında transferi əhatə edir. Villöz hüceyrələrdə məhlulların parasellüler daşınmasına mane olan sıx hüceyrədaxili birləşmələr var. Bu marşrutdan hərəkət radiusu təxminən 8 Å [17]-dən az olan molekullarla birləşmə kompleksi ilə məhdudlaşır. Bir peptid parasellüler yoldan keçə bilsə, hüceyrədaxili proteazlar tərəfindən həzm olunmayacaq. Bu səbəbdən parasellüler marşruta üstünlük verilsə də, onların paraselüler daşınmasını təşviq edə bilən peptidlərin struktur xüsusiyyətləri yaxşı başa düşülmür. N-oktanol və su arasında bölünmə əmsalı bir proqnozlaşdırıcı ola bilər və log P sıfırdan az olan dərmanlar (yəni, əksər peptidlər kimi hidrofilik molekullar) parasellüler yolu izləmək ehtimalı daha yüksəkdir. Parasellüler yolu izləyən peptidlər, bağırsaq hüceyrələri arasında sıx birləşmələri geri döndərən şəkildə aça bilən zonula occludens toksini (ZOT) kimi penetrasiya gücləndiricilərindən daha çox təsirlənə bilər [18]. Parasellüler daşınma permeatın fiziki xüsusiyyətləri ilə məhdudlaşır. Daha böyük peptidlər (üçdən çox amin turşusu) parasellüler yolla passiv diffuziya yolu ilə adətən kiçik miqdarda udulur. Daha böyük zülallar adətən həzm sistemində udulmasa da, protein antigenləri limfoid toxumasının aqreqatlarını (Ödəyici yamaqlar) üstələyən xüsusi bağırsaq epitel hüceyrələri olan M hüceyrələri tərəfindən qəbul edilə bilər. Parasellüler diffuziya üçün sıx birləşmələrin ümumiyyətlə radiusları 11-15 & Aring-dən çox olan molekullar üçün keçirməz olduğu bildirilmişdir ki, bu da sferik sərt molekulların ağızdan ötürülməsi üçün hidrodinamik radiusun həddi ola bilər. Bununla belə, peptidlər müəyyən uyğunlaşma çevikliyinə malikdir və hətta daha böyük molekul skanları sıx birləşmələrə nüfuz edir [19].

5. Peptidlərin çatdırılma yeri

Müxtəlif peptidlər bağırsağın müxtəlif bölgələrindən bir neçə yolla sorulur. Bunun distal bölgədə proteolitik aktivliyin azalması ilə bağlı olduğu güman edilir. Həmçinin distal bölgənin udulma sahəsinin azalmasına baxmayaraq daha yüksək parasellüler keçiricilik var [20]. Sitoplazmada proteaz aktivliyi regional dəyişkənlik göstərmir, lakin eyni şey fırça sərhədi və ya lüminal maye üçün keçərli deyil. Aşağı pH və enzimatik aktivliyi ilə mədə, bir protein dərmanı üçün çox çətin şərtlər təqdim edir. Mədədə bir dozaj formasının həllinin qarşısını almaq üçün tipik bir yanaşma, enterik örtükdən istifadə etməkdir.

Bağırsaq seqmentləri daha distal hissələrdə getdikcə daha az və kiçik villi olur. Bu, kolon müəyyən uzunluq üçün ən aşağı səth sahəsinə malik olmaqla, tədricən azaldılmış səth sahəsinə gətirib çıxarır. Kolonda həmçinin dəyişən pH və dərmanın udulmasına mane ola biləcək bərk nəcis var. Bununla belə, kolon nisbətən aşağı enzimatik aktivliyə malikdir və bu baxımdan perspektivlidir. İzolyasiya edilmiş luminal fermentlərdən və bütöv selikli qişada aparılan tədqiqatlardan istifadə edərək, kalsitoninin kolonla müqayisədə nazik bağırsaqda daha çox parçalanması aşkar edilmişdir [21]. Kolonda çox sayda bakteriya, əsasən anaerob növlər var. Bu fakt peptidləri və zülalları qalın bağırsağa yönəltmək üçün ustaca bir yanaşma üçün istifadə edilmişdir [22].Tədqiqatda insulin və ya vazopressin kimi polipeptidlər siçovulların mədə və nazik bağırsağında ağızdan qəbul edilən polipeptidləri həzmdən qorumaq üçün azo-aromatik qruplarla çarpaz bağlanmış polimerlərlə örtülmüşdür. Polipeptid yoğun bağırsağa çatdıqdan sonra yerli mikroflora azo bağları azaldır, beləliklə çarpaz əlaqələri qırır və polipeptidi udmaq üçün buraxır. Yoğun bağırsağın yuxarı yarısı qaraciyər portal venaları, aşağı yarısı isə limfa axını ilə axıdılır. Qaraciyərdə bir polipeptid məhv olarsa, örtünün qalınlığını və ya tərkibini tənzimləmək mümkün ola bilər ki, dərman qaraciyər damarlarını yan keçərək aşağı kolonda sərbəst buraxılsın. İnsulinin və udma promotorunun qalın bağırsağa çatdırılması da pH-dan asılı xüsusiyyətlərə malik poliakrilik polimer (Eudragit) ilə örtülmüş yumşaq jelatin kapsuldan istifadə etməyə cəhd edilmişdir [23]. In vitro şəraitdə siçovulların və mini donuzların qalın bağırsağın selikli qişasına insulinə bənzər böyümə faktoru I (IGF-I) verilməsi tədqiq edilmişdir. IGF-I, bioloji təsirini xüsusi IGF-I reseptorları vasitəsilə həyata keçirən 70 amin turşusundan ibarət 7649-Da proteinidir. Klinik tədqiqatlarda insulinə davamlı diabetik xəstələrdə qan qlükoza səviyyəsini azaltmaq üçün faydalı olduğu aşkar edilmişdir. IGF-I tərs fazalı yüksək performanslı maye xromatoqrafiyası (RP-HPLC), natrium dodesil sulfat və ndashpoli akrilamid gel elektroforezi (SDSPAGE) və Western blotting [24] ilə müəyyən edildiyi kimi siçovul bağırsağının selikli qişası boyunca bütöv şəkildə udulmuşdur. Kolon spesifik çatdırılması üçün zamana əsaslanan dərman buraxma sistemi hazırlanmışdır. Bu sistem doza formalarının nisbətən sabit nazik bağırsaq tranzit vaxtından istifadə edir [11]. Vaxta əsaslanan sistemlər, pH, subyektin həzm vəziyyəti və buraxılış anındakı anatomik vəziyyət kimi normal fizioloji şərtlərdən asılı olmayaraq, gecikmə vaxtı əvvəlcədən müəyyən edilmiş gecikmə müddətindən sonra öz dərmanlarını buraxmaq üçün tərtib edilə bilər [19,25].

İnsulinin siçovul bağırsağından görünən keçiriciliyi siçovulların bağırsaq kisəsində qarşısının alınması üsulu ilə ölçülən sahədən asılı dəyişkənliyi göstərir. Jejunum və ileumda keçiricilik onikibarmaq bağırsağa nisbətən əhəmiyyətli dərəcədə böyük idi. Bunlarda in vitro Təcrübələrdə insulin olduqca sabit idi. Bu, fırça sərhədində insulin mübadiləsinin əhəmiyyətli olmadığını göstərir. Bununla belə, insulin bağırsaq homogenatlarında demək olar ki, tamamilə metabolizə edilmişdir. Beləliklə, görünür ki, in vivo şəraitdə insulinin deqradasiyası luminal və sitozol fermentlərinin təsiri ilə baş verir [1]. Yerində Təcrübələr göstərdi ki, insulinin mütləq bioavailability siçovul bağırsağının daha distal nahiyəsinə yeridildikdə bağırsağın daha proksimal nahiyəsindən sorulandan daha yüksək olub [26]. Diabetik siçovullara tətbiq edilən izobutil siyanoakrilat nano kapsullardan insulinin udulması udma yerindən asılı idi. Müxtəlif yerlərdən udulduqdan sonra hipoqlikemik təsir aşağıdakı kimi olmuşdur: ileum, mədə, onikibarmaq bağırsaq və jejunum və kolon.

6. Peptidlərin çatdırılması üçün strategiyalar

Beş əsas üsul ən vacib strategiyalardır, o cümlədən: kimyəvi modifikasiya, bioadheziv ötürücü sistemlər, nüfuz artırıcılar, proteaz inhibitorları, daşıyıcı sistemlər. Yaxın gələcəkdə nəzərdən keçiriləcək bu baxışın sonunda istinad edilən digər tərtib və qaydalar.

6.1 Kimyəvi modifikasiya

Daşıyıcı molekullar yerli peptidləri geri qaytarmaq üçün qeyri-sabitləşdirmək üçün istifadə olunur. Daşıyıcı və qismən açılmamış zülal konformasiyası arasında kovalent olmayan bu qarşılıqlı təsir hidrofobik yan zəncirlərin həlledici təsirini artırır və bununla da lipidlərin həll olunma qabiliyyətini və zülalın passiv və transcellular yolla udulmasını artırır [27]. Kimyəvi modifikasiya yanaşması zülalların struktur mürəkkəbliyinə görə zülallardan daha çox peptidlərə tətbiq edilir. Peptidin enzimatik dayanıqlığını və ya membran keçiriciliyini yaxşılaşdırmaq üçün kimyəvi cəhətdən dəyişdirilə bilər. Məsələn, ilkin strukturda D-amin turşularının L-amin turşuları ilə əvəz edilməsi peptidin enzimatik dayanıqlığını yaxşılaşdıra bilər. Membran keçiriciliyinə təsir etmədən enzimatik sabitliyin artması ilə nəticələnən peptidin kimyəvi modifikasiyasına təbii olaraq meydana gələn penta-peptid metionin (Met)-enkefalinin müxtəlif analoqları misal ola bilər. Bu analoqların BBMV-lər tərəfindən metabolizmi deqradasiya dərəcələrində böyük fərqlər göstərir, lakin onların hamısı Caco-2 hüceyrələri arasında oxşar effektiv keçiriciliyə malikdir [28].

Kimyəvi modifikasiyanın başqa bir ipucu, lipofilik peptidin, siklosporin A-nın mədə-bağırsaq traktından asanlıqla sorulmasından irəli gəlir. Beləliklə, səylər bir yağ turşusunun asil qrupunu peptidin amin terminalına bağlamaqla peptidlərə lipidlərin həll edilməsinə yönəldilmişdir. Tripeptidlərdən zülallara qədər bir sıra istifadə edərək, tirotropin azad edən hormon, tetra-qastrin, insulin və lizozim üçün lipidlərin həll olunma qabiliyyəti əldə edildi. Bu yeni törəmələr öz bioloji aktivliyini qoruyub saxlamış və bağırsaqdan udulmasını artırmışdır [29]. Lipofilliyi artırmaq üçün başqa bir yanaşma, yüklü N- və C-terminal qruplarını aradan qaldıracaq, molekulun ümumi həlledicinin əlçatan səth sahəsini azaldacaq siklizasiya ola bilər. Həmçinin, bioloji aktivliyin itirilməməsi şərti ilə peptid analoqlarını sintez etmək üçün t-butil qlisin, b-naftil alanin və p-fenil fenilalanin kimi daha çox lipofilik sintetik amin turşularından istifadə edilə bilər. Lipidlərin struktur xüsusiyyətlərini amin turşuları və peptidlərin xüsusiyyətləri ilə birləşdirən konjugat sistemin istifadəsi, ehtimal ki, konjugat üçün yüksək dərəcədə membrana bənzər bir xarakter təmin edə bilər ki, bu da onun membranlardan keçməsini təmin edə bilər [30]. Somon kalsitoninin kimyəvi modifikasiyası da onun ağızdan udulmasını mümkün etmək üçün edilmişdir. Tədqiqatda somon kalsitonini yağ turşusu-polipeptid konjugatlarını hazırlamaq üçün yeni üsulla dəyişdirilmiş, sulu məhlullarda həyata keçirilə bilər və toxumalarda və ya qanda orijinal aktiv polipeptidi bərpa edə bilər. Bu geri dönən sulu lipidləşmə yanaşmasından istifadə edərək, şifahi olaraq qəbul edilən dəyişdirilmiş kalsitoninin əyri altındakı sahəsi (AUC) dəyişdirilməmiş kalsitonininkindən təxminən 20 dəfə yüksək idi [19]. PEGilləşdirilmiş zülallar da ağızdan çatdırılma potensialına malik ola bilər. Rekombinant insan qranulosit koloniyalarını stimullaşdıran amilin PEGilasiyası, intraduodenal yolla yeridildikdə onun stabilliyini və in vivo bioaktivliyini artırdığı bildirilmişdir. Daxili yolla onun bioavailability 1,8-3,5 faiz təşkil edirdi, dəyişdirilməmiş zülal heç bir ölçülə bilən cavab vermədi [31].

Kimyəvi modifikasiya həmişə ağızdan sorulmanın yaxşılaşmasına səbəb olmur. İn vitro şəraitdə insulinin diasil törəmələri siçovulların nazik bağırsağında yerli insulinə nisbətən daha yüksək proteoliz nümayiş etdirmişdir. Bunun səbəbi, insulin assosiasiyasının diasilasiya ilə inhibə edilməsi, proteoliz üçün daha çox monomerin mövcud olması idi [32]. Peptid preparatlarının bağırsaqdan sorulması üçün struktur tələbləri nəzərdən keçirilmişdir [23]. Barlow və Satoh [9] güclü, spesifik və udula bilən peptid dərmanının əsas dizayn xüsusiyyətlərini müəyyən etmək üçün bir sıra elementar təhlillər apardılar. Peptidin hədəf reseptoru tərəfindən tanınması üçün təxminən 4-6 amin turşusu qalığına ehtiyac olduğu görünür və strukturun qalan hissəsi bioaktivlik üçün &ldquoredundant&rdquo ola bilər. Yaranan struktur hələ də parasellüler daşıma ilə daşınmaq üçün çox böyükdür. Həmçinin, üç qalıqdan daha böyük molekullar üçün peptid daşıyıcılarının mövcud olma ehtimalı azdır, ona görə də aktiv daşınma da mümkün deyil. Sadə diffuziya yolu ilə daşınması üçün peptidin lipofilliyini artırmaq lazımdır. Molekulyar modelləşdirməyə əsaslanaraq, aktiv sorulan peptidin ümumi səth sahəsinin təxminən 350 Å2 olması, bunun da qütb səthinin 50 Å2 və ya daha az olması proqnozlaşdırıldı. Bu, peptid NH qruplarının metilasiyası ilə cəhd edilə bilər, yüklənmiş sonları və ya molekulun siklizasiyasını aradan qaldıraraq, peptid CO və NH qruplarını molekuldaxili hidrogen bağı səbəbindən həll etmək üçün əlçatmaz edir. Peptidlərin dizaynı və ya onların ağızdan udulmasını proqnozlaşdırmaq üçün kompüter simulyasiyaları mümkün ola bilər. Kütləvi tarazlıq yanaşması əsasında peptidlərin udulmasının dərəcəsini qiymətləndirmək üçün nəzəri təhlil işlənib hazırlanmışdır. Bu analizdən istifadə edərək, simulyasiyalar göstərdi ki, insulinin bağırsaqda udulması qəbul edilən dozanın təxminən 1 faizini təşkil edir [33]. Bəzi peptid daşıyıcılarının bağırsaq mukozasında mövcud olduğu bilindiyi üçün onun strukturu haqqında bilik bu reseptor üçün yaxınlıq göstərən peptid mimetikasının rasional dizaynına səbəb olacaqdır. Bununla belə, substratın spesifikliyinə görə passiv diffuziya məhdud olacaq. Dərman çatdırılmasına nail olmaq üçün peptidlərin struktur xüsusiyyətləri mütləq bioaktivlik üçün tələb olunanlarla eyni deyil. Buna görə də, adekvat ağızdan absorbsiyaya malik peptid mimetikasının rasional dizaynı üçün multidissiplinar komandanın birgə səyi tələb olunur [33].

Qısaca, peptidlərin ümumi standart modifikasiyaları arasında aşağıdakıları qeyd etmək olar:

- Qeyri-təbii amin turşuları (6-aminokaproik turşu, amin butirik turşu, sitrulin, norleucin və s.)

- Ağır amin turşuları (13C və/və ya 15N ilə işarələnmiş)

- fosforilləşmə və ya kükürdləşmə (Ser, Tyr, Thr-da)

- daşıyıcı zülallara konjugasiya (BSA, KLH, OVA)

- Peptidlərin budaqlanması (MAP və çoxlu antigen peptidlər)

6.2 Bioadheziv ötürücü sistemlər

Ağızdan peptid istehlakını hazırlamaq üçün bioadheziv ötürücü sistemlər geniş şəkildə tədqiq edilmişdir [34]. Bu, peptidin udulması üçün ümumi vaxtı artırır, çünki çatdırılma sistemi xaric edilməsi üçün mədə-bağırsaq tranzit müddətindən asılı olmayacaqdır. Peptidlər selikli qişanın epitelinə çatmaq üçün luminal məzmun və ya selikli təbəqə vasitəsilə yayılmağa məcbur olmayacaqlar. Selikli qişa ilə intim təmasda olduğundan, udulmaq üçün yüksək bir dərman konsentrasiyası təqdim olunur. Həmçinin, həzm sisteminin müəyyən bir yerində bioadheziya baş verə bilərsə, sahəyə xüsusi çatdırılma mümkün ola bilər. Bioadheziv tədarük sistemləri həzm sistemində selik dövriyyəsi müddətindən təsirlənə bilər ki, bu da ərazidən asılı olaraq dəyişir. Siçovulların həzm sistemində polikarbofil disklərin mukoadeziyası üçün ən yaxşı yer kolon və kor bağırsaq olduğu müəyyən edilmişdir. Adi dərman molekullarının ağızdan ötürülməsi üçün mukoadheziv bağırsaq yamaqları da tədqiq edilmişdir [5]. Peptid preparatlarının ağızdan sorulmasını yaxşılaşdırmaq üçün bioadheziv polimerlərdən istifadə etmək olar. Bioadheziv polimerlər, polikarbofil və xitosan törəmələri siçovulun şaquli perfuziyalı bağırsaq ilmə modelində 9-desglisinamid, 8-argininevasopressinin (DGAVP) peptid dərmanının udulmasını artırmaq üçün istifadə edilmişdir [35]. Bukkal yapışdırıcı sistemlər əlçatanlıq, tətbiq və geri çəkilmə, qəbuledicilik, aşağı enzimatik aktivlik, qənaət və yüksək xəstə uyğunluğu baxımından saysız-hesabsız üstünlüklər təklif edir. Bu dərman ötürmə cihazlarının selikli qişalara yapışması absorbsiya yerində dərman konsentrasiyası qradientinin artmasına səbəb olur və buna görə də sistemli şəkildə ötürülən dərmanların bioavailability yaxşılaşır. Digər innovativ dərman daşıma sistemlərini tapmaq üçün ənənəvi polimer şəbəkələrindən kənarda araşdırmalar davam edir. Mövcud qlobal ssenaridə elm adamları pH modifikatorlarının, ferment inhibitorlarının, nüfuzetmə gücləndiricilərinin və s. daxil edilməsi kimi formulasiya strategiyalarının manipulyasiyası yolu ilə şifahi olaraq istifadə edilən dərmanların bioavailliyini yaxşılaşdırmaq üçün müxtəlif yanaşmalar vasitəsilə bukkal yapışqan sistemləri inkişaf etdirməyin yollarını tapırlar. Gələcək istiqamət Bukkal yapışan dərmanın çatdırılması peptidlərin və peptidlərin hazırlanmasında yatır.

Digər mühüm aspekt materialların və dozaj formalarının fəaliyyətinin qiymətləndirilməsi üçün istifadə edilən in vitro və ex vivo üsullara aiddir. Mukoadezyona təsir edən mühüm amillər, o cümlədən:

o Aktiv polimerin konsentrasiyası

o Polimerin zəncirvari elastikliyi

o Funksional Qrup töhfəsi

&bull Ekoloji &ndash Əlaqədar Faktorlar: 21-25

o Model substrat səthinin seçilməsi

6.3 Penetrasiya gücləndiriciləri

Bu yaxınlarda peptidlər dəriyə nüfuz edən peptidlər (SPP) və/və ya hüceyrəyə nüfuz edən peptidlər (CPP) kimi penetrasiya gücləndiriciləri hesab olunurlar və son illərdə geniş diqqət topladılar və makromolekulların dəriyə və ya dəriyə çatdırılması üçün sadə və effektiv qeyri-invaziv strategiya kimi ortaya çıxdılar. müvafiq olaraq hüceyrələr. Ümumiyyətlə, penetrasiya gücləndiriciləri transcellular və ya parasellüler yolda hərəkət edərək ağızdan absorbsiyanı yaxşılaşdıra bilər. Hüceyrələrarası yola təsir etmək üçün səthi aktiv maddələr və yağ turşuları membranın lipid quruluşunu dəyişdirə bilər və bununla da ağızdan nəqli artıra bilər. Səthi aktiv maddələr lipid iki qatına daxil edilə bilər, beləliklə hüceyrə membranlarının fiziki xüsusiyyətlərini dəyişir. Parasellüler yola təsir etmək üçün xelatlaşdırıcı maddələr sıx birləşmələr ətrafında kalsium və ya maqneziumu xelatlaşdıraraq qovşaq komplekslərinin bütövlüyünü poza bilər [36]. Natrium deoksixolat və natrium xolat kimi safra duzları da polipeptidlərin ağızdan sorulmasını artırmaq üçün kolon qarışıq miselyar sistemlərdən insulinin udulmasını təşviq etmək üçün formulada istifadə edilə bilər [37]. Bu cür sistemlərin lipidlərin udulmasına kömək etmək üçün mədə-bağırsaq sistemində təbii şəkildə əmələ gəldiyi də məlumdur. Pəhriz yağları əvvəlcə bağırsaqda öd duzları ilə emulsiyaya uğrayır, sonra isə pankreas lipazının təsiri ilə monogliseridlər və sərbəst yağ turşuları əmələ gəlir. Natrium qlikol xolatları, emulqator və udma promouterindən istifadə edərək yağ turşularında insulinin lipoid dispersiyaları tədqiq edilmişdir. Dovşanlara ağızdan tətbiq edildikdən sonra hipoqlikemik təsirlərin istifadə edilən yağ turşusundan asılı olduğu aşkar edilmişdir. Penetrasiya gücləndiriciləri mədə-bağırsaq traktının bəzi xüsusi bölgələrində dərmanların udulmasını artıra bilər. Siklodekstrinlər həmçinin in situ qapalı dövrə üsulu ilə siçovulun aşağı jejunal/yuxarı ileal seqmentlərindən insulinin udulmasını artırmaq üçün istifadə edilmişdir.

Ağızdan absorbsiyanı artırmaq üçün penetrasiya gücləndiricilərindən istifadə edildikdə, onların istifadə üçün ümumi qəbul edilməsinə mane ola biləcək məhdudiyyətlərin olduğunu başa düşmək olar. Həmçinin, penetrasiya gücləndiricilərinin spesifikliyinin potensial çatışmazlığı yalnız xroniki tədqiqatlarda qiymətləndirilə bilən uzunmüddətli toksiklik nəticələrinə malik ola bilər. Səthi aktiv maddələrin potensial litik təbiəti təhlükəsizliklə bağlı narahatlıq doğurur, çünki bağırsaq epiteli toksinlərin, bakteriyaların və virusların daxil olması üçün maneə yaradır. Eynilə, Ca2+ tükənməsinə səbəb olan xelatorlar xüsusi olaraq sıx birləşmələrdə hərəkət etmir, əksinə hüceyrələrdə qlobal dəyişikliklərə səbəb ola bilər, məsələn aktin filamentlərinin və ya yapışan birləşmələrin pozulması. Beləliklə, sıx qovşaqların açılmasını sürətli, geri dönə bilən və təkrarlana bilən şəkildə induksiya etmək çətin olacaq [37].

6.4 Proteaz inhibitorları

Proteaz inhibitorları həmçinin mədə-bağırsaq traktında onların proteolitik parçalanmasını azaltmaqla terapevtik peptidlərin və zülalların ağızdan sorulmasını təşviq edə bilər. Ümumiyyətlə, inhibitor agentlər (1) polipeptid proteaz inhibitorları (məsələn, aprotinin) (2) peptidlər və dəyişdirilmiş peptidlər (məsələn, bacitracin, ximostatin və amastatin) (3) amin turşuları və dəyişdirilmiş amin turşuları (məsələn, a-) kimi təsnif edilə bilər. aminoboron turşusu törəmələri) və (4) başqaları (məsələn, p-aminobenzamidin və kamostat mesilat) [38]. Bir amin peptidaz inhibitoru olan amastatinin yüksək pH-da penta peptid, lösin (Leu)-enkefalinin (YGGFL) hidrolizini azaltdığı bildirilmişdir. Aşağı pH-da (5.0-dən aşağı) endopeptidaza inhibitorları, YGG və GGF tripeptidlərinin təsirli olduğu aşkar edilmişdir. YGGFL-nin amin və endopeptidaza inhibitorlarının kombinasiyası ilə koperfüzyonu siçovulların jejunumunda hidrolizin qarşısını almaq üçün ən təsirli olmuşdur. Bu inhibitorlar olmadıqda, YGGFL-nin geniş hidrolizi siçovulların jejunumunda, ilk növbədə, fırça sərhədi fermentləri və ikincisi, luminal peptidazalar tərəfindən müşahidə edilmişdir [39]. Başqa bir araşdırmada, bir aminopeptidaza inhibitoru (puromisin) siçovulların bağırsağında Met-enkefalinin stabil analoqu olan metkefamidin (MKA) udulmasını artıra bildi. Bununla belə, bu işdə bir endo-peptidaz inhibitoru (tiorfan) təsirsiz idi. Bunun səbəbi, udulma zamanı MKA metabolizmində iştirak edən dominant fermentin amin-peptidaza olmasıdır [40].

Öd duzları, penetrasiya gücləndiriciləri kimi fəaliyyət göstərməklə yanaşı, ağızdan absorbsiyanı artırmaq üçün proteaz inhibitorları kimi də çıxış edə bilər. Öd duzlarının fırça sərhəd membranını və sitozolik proteolitik hidrolizi maneə törətdiyi göstərilmişdir və beləliklə, peptid dərmanlarının bağırsaqda deqradasiyasını azaltmaq üçün faydalı olacaqdır [10]. Bir bakterial proteaz inhibitoru Brusella abortus U-Omp19 adlanan yoluxucu xəstəliklərə qarşı şifahi peyvənd formulası üçün ideal tərkib hissəsi kimi bildirilmişdir. U-Omp19 şifahi olaraq qəbul edildikdə Toxoplasma gondii antigen (Ag), U-Omp19: i) mədə və bağırsaq proteazlarını inhibə edərək mədə-bağırsaq traktının sərt mühitindən yan keçə bilər və nəticədə immun induktiv yerlərdə birgə tətbiq edilən Ag-nin yarı ömrünü artırmışdır. Nəhayət, oral peyvənd formulasındakı bu bakterial proteaz inhibitoru, virulentlə oral sınaqdan sonra selikli qişanın qorunmasını təmin etdi və parazit yüklərini azaltdı. Toxoplasma gondii [41]. Siçovullarda qapalı kiçik və qalın bağırsaq ilmələri ilə in situ tədqiqatda tək insulinin tətbiqi zamanı heç bir nəzərə çarpan hipoqlikemik reaksiya müşahidə edilməmişdir. Bununla belə, insulinin 20 mM natrium qlikokolat, kamostatmesilat və bacitrasin ilə qalın bağırsaqdan tətbiqindən sonra əhəmiyyətli hipoqlikemik təsir əldə edilmişdir [42]. Əgər siçovul bağırsağında insulinin proteolizinin qarşısını almaq üçün soya tripsin inhibitoru kimi bir proteaz inhibitorundan istifadə edilərsə, onun udulması bağırsaqda mövcud olan endogen öd turşuları tərəfindən təşviq edilir [43]. Başqa bir araşdırmada insulinin oral bioavailability yaxşılaşdırılması üçün proteaz inhibitorlarının birgə tətbiqi ilə insulin deqradasiyasının azalması bildirilmişdir. Bu işdə həm arıq, həm də şəkərli diabet səbəb olduğu piylənmə siçovul modellərində qan qlükoza səviyyəsinin əhəmiyyətli dərəcədə azalması, həmçinin peptidaz inhibitoru ilə oral insulinin tətbiqindən 20 dəqiqə və 135 dəqiqə sonra plazma insulin səviyyələrində əhəmiyyətli artım göstərilmişdir [44] . Çox kiçik dozalarda (təxminən 1 mq) vazopressin məhlulda ağızdan tətbiq edildikdən sonra siçovullarda diurez əleyhinə təsir göstərir. Proteaz inhibitoru olan 1000 vahid aprotinin eyni vaxtda tətbiqi ilə AVP və LVP üçün bioloji reaksiya gücləndirildi. Sintetik analoq DDAVP təbii hormonlardan daha aktiv idi, lakin aprotinin DDAVP ilə təsiri uyğunsuz idi.DDAVP-nin nisbətən daha böyük oral fəaliyyətinə qeyri-təbii D-arginin səbəb olur ki, bu da onu tripsinin hücumuna davamlı edir. Nişasta-poli (akril turşusu) kopolimerləri və nişasta/poli (akril turşusu) qarışıqları sintez edilmişdir və onların proteolitik fermenti inhibə etmə fəaliyyətinə və ion bağlama qabiliyyətinə görə peptidlərin ağızdan ötürülməsini təmin etmək potensialına malik ola bilər [20].

6.5 Daşıyıcı sistemlər

Nanohissəciklər, mikrosferlər, liposomlar və ya eritrositlər kimi daşıyıcı sistemlər də peptidlərin və zülalların ağızdan udulmasını yaxşılaşdırmaq üçün istifadə edilə bilər. Emisphere Technologies, Incorporated (Tarrytown, NY) daşıyıcı eligen® texnologiyasından istifadə edərək insulinin ağızdan verilməsi üçün klinik sınaqlara başladı. Şirkət, həmçinin Novartis ilə əməkdaşlıqda rekombinant insan böyümə hormonunun oral çatdırılmasına başlamışdır və hazırda kalsitoninin ağızdan verilməsi üçün II faza klinik sınaqlarındadır. Bu daşıyıcı molekullar yüksək konsentrasiyalarda zülalın daha yüksək ağız keçiriciliyinə malik olan qismən açılmamış və ya ərimiş qlobul vəziyyətinə uyğunlaşma dəyişikliyinə məruz qalmasına səbəb olur. Daşıyıcı molekullar molekulyar çəkisi təxminən 200 ilə 400 Da arasında olan kiçik üzvi molekullardır. Zülal kimyəvi modifikasiya yanaşması ilə deyil, öz doğma vəziyyətində istifadə olunur və daşıyıcı ilə zülal arasındakı qarşılıqlı əlaqə kovalent deyil. Hüceyrə monoqatlarından istifadə etməklə hüceyrələr arasında sıx birləşmələrin pozulmadığı göstərilmişdir. Şirkət həmçinin şifahi çatdırılma texnologiyası üçün konsepsiyanın sübutunu nümayiş etdirmək üçün PYY 3-36-dan istifadə etmişdir. PYY 3-36 qida qəbulunu fizioloji cəhətdən maneə törədən və piylənmənin müalicəsi üçün potensiala malik olan 34 qalıq bağırsaq hormonudur [12,45]. Anesteziya edilmiş diabetik siçovullarda intraduodenal administrasiyadan sonra insulinin udulmasını yaxşılaşdırmaq üçün müxtəlif daşıyıcı sistemlərin istifadəsi qiymətləndirilmişdir. Bir neçə eritrosit və ndashmembran daşıyıcı sistemləri sınaqdan keçirilmişdir. Bunlara insan qırmızı qan hüceyrələrinin hemolizindən hazırlanmış eritrosit xəyalları (EG), EG suspenziyasının sonikasiyası ilə hazırlanmış eritrosit vezikülləri (EV) və liposomları birləşdirən xəyallar və ya veziküllər (müvafiq olaraq, LEG və LEV) daxildir. Nəzarət qrupu ilə müqayisədə bu daşıyıcılar insulinin ağızdan udulmasını artırmışlar, LEV isə daha effektiv çatdırılma üçün ən yaxşı daşıyıcıdır [45].

Liposomların Payer yamaqları tərəfindən qəbulu hər hansı bir qapalı dərmanın qəbulunu artıra bilər. Ən azı 25 mol fosfatidil serin olan mənfi yüklü liposomların intra-luminal tətbiqdən sonra siçovul Payer yamaqları tərəfindən asanlıqla qəbul edildiyi bildirildi. Albom kimi zülallar mədə-bağırsaq traktında dərmanların dayanıqlığını yaxşılaşdırmaq üçün mikro hissəciklər hazırlamaq üçün də istifadə edilmişdir. Termal olaraq qatılaşdırılmış amin turşuları (proteinoidlər) turşu mühitə məruz qaldıqda kortəbii olaraq mikrosferlər əmələ gətirə bilər. Proteinoid mikrosferlərdən siçovullara və meymunlara kapsullaşdırılmış kalsitonini çatdırmaq üçün müsbət nəticələrlə istifadə edilmişdir. Siçovullarda kapsullaşdırılmış kalsitoninin qəbulundan 1 saat sonra serum kalsium səviyyəsi 23 mq/ml azalmışdır. Bunun əksinə olaraq, nəzarət kalsitonini (mikrosferlər yoxdur) qəbul edən siçovullarda yalnız 6,5 mq/ml azalma müşahidə olunub [1].

Nano-hissəcik formulalarından istifadənin liposom formulaları kimi digər üsullardan üstünlüyü dərmanın sabitliyini, udulmasını və hədəflənməsini yaxşılaşdırmaq qabiliyyətinə əlavə olaraq idarə olunan buraxılma qabiliyyətidir [44]. Siçanlara oral tətbiq edildikdən sonra 14C etiketli poli (D, L-laktid-ko-qlikolid) nanohissəciklərinin sorulması və toxuma paylanması venadaxili yolla verilən üsulla müqayisədə müəyyən edilmişdir. Nanohissəciklərin mədə-bağırsaq tranziti çox sürətli idi, radioaktivliyin böyük hissəsi qəbuldan 4 saat sonra kolonda və tətbiqdən 24 saat sonra nəcisdə sürətlə görünür. Bağırsaq baryeri vasitəsilə udulmuş miqdarın (təxminən 2%) ən çoxu karkasda və qaraciyərdə aşkar edilmişdir [16]. Nanokapsüllər əvvəlcə Ödəyicinin yamaqları vasitəsilə udulmağa üstünlük verə bilər və M hüceyrələrində və limfa hüceyrələrinin ətrafındakı hüceyrələrarası boşluqlarda görünə bilər. Görünür, Payer yamaqlarının bu tutulması ileumda xüsusilə vacibdir. Jejunumda nano-kapsulların udulması parasellüler yolla, ola bilsin ki, villi ucunda yaxşı differensiallaşmış uducu hüceyrələrin desquamasiyası nəticəsində əmələ gələn hüceyrələrarası boşluqlar vasitəsilə ola bilər [16]. Lösin-5-enkefalin model dərmanının palmitik efir preparatı xitozan amfifil nanohissəcikləri daxilində kapsullaşdırılıb. Palmitin turşusu leysin-5-enkefalinin lipofilliyini artırmaq üçün, həmçinin plazmadakı peptidi sabitləşdirmək üçün istifadə edilmişdir və mədə-bağırsaq traktının udulmasını artırmaq üçün xitosan amfifil nanohissəcikləri istifadə edilmişdir. Ağız yolu ilə nano-hissəcikli pro-dərman formulası beyin dərman səviyyəsini 67% artırdı və lösin5-enkefalinin anti-nosiseptiv fəaliyyətini əhəmiyyətli dərəcədə artırdı. Nano-hissəciklər ağızdan sorulmağı asanlaşdırdı və pro-dərman beynin çatdırılmasına imkan verən plazma deqradasiyasının qarşısını aldı [46]. Sərbəst insulin eyni eksperimental şəraitdə şifahi olaraq qəbul edildikdə qlikemiyaya təsir göstərməmişdir. Siçovullarda poli-izobutil siyano-akrilat nanohissəcikləri ilə əhatə olunmuş insulin və kalsitoninin bağırsaqdan sorulması araşdırılmış və nəticədə farmakokinetik profillər davamlı çatdırılma üçün xarakterik olmuşdur. Nisbətən daha yüksək plazma konsentrasiyası sonrakı vaxtlarda müşahidə edildi, lakin daha aşağı ilkin konsentrasiyalarla tarazlaşdırıldı, beləliklə, udulmanın əhəmiyyətli xalis artması müşahidə edilmədi. Bu, nano-kapsulaların peptidi yavaş-yavaş bağırsaq lümeninə buraxdığını, kiçik miqdarda udulduğunu göstərir [47]. Polimeta-krilikasid-paylanmış-poli (etilen qlikol) dən ibarət hidrogel nano-kürələri də oral zülal çatdırılması üçün araşdırılmış və Caco-2 hüceyrə mono-qatlarında epitel hüceyrələri arasında sıx birləşmələri açmağa qadir olduğu bildirilmişdir [48] . Beləliklə, mövcud biliklərimiz peptidlərə əsaslanan dərmanların təkcə xəstəliyin yerinə deyil, həm də gücləndirilmiş terapiya üçün hədəf hüceyrənin içərisinə çatdırılmasına dair bəzi perspektivli yanaşmalar təqdim edir. Elektro-porsiya və ya mikroinyeksiya kimi hüceyrədaxili çatdırılmanın ənənəvi üsulları invazivdir və in vitro təcrübələr üçün tətbiq olunur, lakin klinik şərait üçün deyil. Müxtəlif farmasevtik nano-daşıyıcıların, məsələn, pH-həssaslığına malik olan və endositik qəbul zamanı endosomlardan qaça bilən lipozomların istifadəsi və ya peptid və zülal preparatlarının hüceyrəyə nüfuz edən peptidlərlə modifikasiyası effektiv və qeyri-invaziv hüceyrədaxili çatdırılmaya imkan verə bilər. . Baxmayaraq ki, pH-həssas əczaçılıq nano-daşıyıcıları və hüceyrəyə nüfuz edən peptidlə dəyişdirilmiş dərmanlar və dərman daşıyıcıları ilə aparılan təcrübələrin əksəriyyəti hələ də klinikadan əvvəlki mərhələdə olsa da, biz bu üsullara əsaslanan yeni dərman vasitələrinin və müalicə protokollarının ortaya çıxmasını gözləyə bilərik. yaxın gələcək (Şəkil 2).

6.6 Digər formulalar

Şəkil 2:(A) Bağırsaq epitel membranı vasitəsilə biopreparatın daşınma mexanizmi, (B) nüfuz gücləndiricisinin ehtimal mexanizmi və (C) ferment inhibitorları, (D) ilkin dərmanın sorulmasının və onun aktivləşdirilməsinin təmsilçi mexanizmi.

Peptidlərin mədə-bağırsaq traktından udulması üçün bir neçə formulalar bildirilmişdir. Yağ fazasında xilomikronlara bənzər lipid tərkibi var. Proteaz inhibitoru olan bir protinin, peptid parçalanmasının qarşısını alacaq, chylomicrons enterositlərə udulmanı yaxşılaşdıracaq. Emulsiya daşıyıcı tozların üzərinə örtülür, sonra onlar sərt jelatin kapsullara doldurulur. Daha sonra mədədə həll olmamaq üçün kapsullar bağırsaqla örtülür. Başqa bir yanaşma peptidin fosfolipidlərə qeyri-kovalent bağlanmasını əhatə edir ki, kompleks endositozla enterositlərə udulsun. Bu yanaşmalar insulin, kalsitonin, donuz somatotropini, eritropoetin və interferon üçün oral reseptorların hazırlanmasında istifadə olunur [48]. Diabetik olmayan və diabetli itlərə insulinin bərk formada ağızdan tətbiqi, insulinin xolat və soya tripsin inhibitoru ilə qarışdırılması və enterokoklu mikro tabletlər şəklində şifahi olaraq verilməsinə cəhd edilmişdir. Dərman qəbul edildikdən sonra plazma insulin səviyyəsi artdı və plazma qlükoza səviyyəsi təxminən 60-140 dəqiqəlik bir fasilədən sonra azaldı. İnsulinin oral yolla ötürülməsi entero-hepatik yolun hədəflənməsinə gətirib çıxardığından, bu tədqiqatın müəllifləri bu və ya oxşar formulanın II tip diabetli xəstələr üçün köməkçi müalicə kimi xidmət edə biləcəyini düşünürdülər [34]. O və b. [49] in vivo olaraq fenofibrik turşusu çatdıra bilən qida zülalları ilə biouyğun nano-emulsiyaları stabilləşdirdi. Bu tədqiqatda qida zülalları (soya zülalının izolatı, zərdab zülalının izolatı və beta-laktoqlobulin) fenofibrik turşusu kimi hidrofobik dərmanların çatdırılması üçün nano-emulsiyalar üçün stabilizator kimi istifadə edilmişdir. Kiçik hissəcik ölçüsü və yaxşı ölçülü paylanması ilə qida zülalları stabilləşdirilmiş nano-emulsiyalar yaxşı sabitlik və bioavailability nümayiş etdirdi. Nano-emulsiyalar lipofilik dərmanın yağ məhlulu ilə müqayisədə daha sürətli və daha yaxşı udulmasına imkan verir, həmçinin səthi aktiv maddələrlə sabitləşmiş nano-emulsiyalara nisbətən zülalla stabilləşdirilmiş nanoemulsiyalarda daha yaxşı sabitlik müşahidə edilmişdir, beləliklə, qida zülalları ənənəvi səthi aktiv maddələr üçün həyat qabiliyyətli əvəzedicilərdir. . Qeyd etmək lazımdır ki, SPI-stabilləşdirilmiş nano-emulsiyaların bioavailability &beta-lg və WPI [49] ilə stabilləşdirilmiş nano-emulsiyalardan dramatik şəkildə yüksək olmuşdur.

7. Nəticə

Zülallar və bir çox peptidlər həzm sistemində həzm olunur. Buna görə də, hormonlar kimi aktiv zülallar və peptidlər ağızdan qəbul edilməməsi səbəbindən şifahi olaraq qəbul edilə bilməz. Mədə-bağırsaq yolu ilə uğurlu peptidin çatdırılması, hər mərhələdə müxtəlif nüfuz və ya enzimatik maneələri keçmək üçün bir sıra hadisələr tələb edir. Proteolitik deqradasiyanı minimuma endirmək üçün sahəyə xüsusi çatdırılma sistemi və yanaşmalar tələb olunur. Penetrasiya gücləndiricilərinin, daşıyıcı sistemlərin, xüsusilə yeni dizayn edilmiş proteaz inhibitorlarının istifadəsi və ya peptidlərin kimyəvi modifikasiyası onların ağızdan çatdırılmasını artırmaq üçün perspektivli yanaşmalar təklif edir. Parasellüler yolla bağırsağın selikli qişasına nüfuz edən və qana udulan sorulan kiçik peptidlərin layihələndirilməsi mümkün yanaşma kimi görünür. Peptid daşıyıcısı1 (PEPT1) ilk növbədə kiçik bağırsağın lümenindən pəhriz di- və tripeptidlərin udulmasına cavabdehdir. PEPT1 tərəfindən substrat tipli qarşılıqlı təsirlər, ana molekulda peptid və peptid bağlarına bənzər hissələr təqdim etmək üçün hazırlanmış pro-dərmanlarla uğurla istifadə edilmişdir. Deyəsən, gələcəkdə proteaz inhibitorları və/və ya kimyəvi modifikasiya ilə istifadə edildikdə mədə-bağırsaq traktından yüksək səviyyədə asanlıqla sorula bilən kiçik peptidlərin qiymətli təsirləri haqqında mühüm şahid bildiriləcək.


Farnesoid X reseptoru insan qaraciyərini repressiya edir APOA gen ifadəsi

1 Molekulyar Biologiya və Biokimya İnstitutu, Molekulyar Tibb Mərkəzi və 2 Eksperimental və Molekulyar Hepatologiya Laboratoriyası, Qastroenterologiya və Hepatologiya Bölməsi, Daxili Xəstəliklər Departamenti, Qraz Tibb Universiteti, Qraz, Avstriya. 3 Kardiologiya şöbəsi, Queensland Universiteti, Mater Adult Xəstəxanası, Brisbane, Avstraliya. 4 Metabolizm Laboratoriyası, Milli Xərçəng İnstitutu, NIH, Bethesda, ABŞ. 5 Qastroenterologiya və Hepatologiya Bölməsi, Daxili Xəstəliklər Departamenti III, Vyana Tibb Universiteti, Vyana, Avstriya.

Yazışma üçün ünvan: Gert M. Kostner, Molekulyar Biologiya və Biokimya İnstitutu, Molekulyar Tibb Mərkəzi, Qraz Tibb Universiteti, 8010 Qraz, Harrachgasse 21, Avstriya. Telefon: 43.316.380.4202 Faks: 43.316.380.9615 E-mail: [email protected]

Chennamsetty, I. tərəfindən məqalələr tapın: JCI | PubMed | Google Alim

1 Molekulyar Biologiya və Biokimya İnstitutu, Molekulyar Tibb Mərkəzi və 2 Eksperimental və Molekulyar Hepatologiya Laboratoriyası, Qastroenterologiya və Hepatologiya Bölməsi, Daxili Xəstəliklər Departamenti, Qraz Tibb Universiteti, Qraz, Avstriya. 3 Kardiologiya şöbəsi, Queensland Universiteti, Mater Adult Xəstəxanası, Brisbane, Avstraliya. 4 Metabolizm Laboratoriyası, Milli Xərçəng İnstitutu, NIH, Bethesda, ABŞ. 5 Qastroenterologiya və Hepatologiya Bölməsi, Daxili Xəstəliklər Departamenti III, Vyana Tibb Universiteti, Vyana, Avstriya.

Yazışma üçün ünvan: Gert M. Kostner, Molekulyar Biologiya və Biokimya İnstitutu, Molekulyar Tibb Mərkəzi, Qraz Tibb Universiteti, 8010 Qraz, Harrachgasse 21, Avstriya. Telefon: 43.316.380.4202 Faks: 43.316.380.9615 E-mail: Ger[email protected]

Claudel, T. tərəfindən məqalələr tapın: JCI | PubMed | Google Alim

1 Molekulyar Biologiya və Biokimya İnstitutu, Molekulyar Tibb Mərkəzi və 2 Eksperimental və Molekulyar Hepatologiya Laboratoriyası, Qastroenterologiya və Hepatologiya Bölməsi, Daxili Xəstəliklər Departamenti, Qraz Tibb Universiteti, Qraz, Avstriya. 3 Kardiologiya şöbəsi, Queensland Universiteti, Mater Adult Xəstəxanası, Brisbane, Avstraliya. 4 Metabolizm Laboratoriyası, Milli Xərçəng İnstitutu, NIH, Bethesda, ABŞ. 5 Qastroenterologiya və Hepatologiya Bölməsi, Daxili Xəstəliklər Departamenti III, Vyana Tibb Universiteti, Vyana, Avstriya.

Yazışma üçün ünvan: Gert M. Kostner, Molekulyar Biologiya və Biokimya İnstitutu, Molekulyar Tibb Mərkəzi, Qraz Tibb Universiteti, 8010 Qraz, Harrachgasse 21, Avstriya. Telefon: 43.316.380.4202 Faks: 43.316.380.9615 E-mail: [email protected]

Kostner, K. tərəfindən məqalələr tapın: JCI | PubMed | Google Alim

1 Molekulyar Biologiya və Biokimya İnstitutu, Molekulyar Tibb Mərkəzi və 2 Eksperimental və Molekulyar Hepatologiya Laboratoriyası, Qastroenterologiya və Hepatologiya Bölməsi, Daxili Xəstəliklər Departamenti, Qraz Tibb Universiteti, Qraz, Avstriya. 3 Kardiologiya şöbəsi, Queensland Universiteti, Mater Adult Xəstəxanası, Brisbane, Avstraliya. 4 Metabolizm Laboratoriyası, Milli Xərçəng İnstitutu, NIH, Bethesda, ABŞ. 5 Qastroenterologiya və Hepatologiya Bölməsi, Daxili Xəstəliklər Departamenti III, Vyana Tibb Universiteti, Vyana, Avstriya.

Yazışma üçün ünvan: Gert M. Kostner, Molekulyar Biologiya və Biokimya İnstitutu, Molekulyar Tibb Mərkəzi, Qraz Tibb Universiteti, 8010 Qraz, Harrachgasse 21, Avstriya. Telefon: 43.316.380.4202 Faks: 43.316.380.9615 E-mail: [email protected]

Baghdasaryan, A. məqalələrini tapın: JCI | PubMed | Google Alim

1 Molekulyar Biologiya və Biokimya İnstitutu, Molekulyar Tibb Mərkəzi və 2 Eksperimental və Molekulyar Hepatologiya Laboratoriyası, Qastroenterologiya və Hepatologiya Bölməsi, Daxili Xəstəliklər Departamenti, Qraz Tibb Universiteti, Qraz, Avstriya. 3 Kardiologiya şöbəsi, Queensland Universiteti, Mater Adult Xəstəxanası, Brisbane, Avstraliya. 4 Metabolizm Laboratoriyası, Milli Xərçəng İnstitutu, NIH, Bethesda, ABŞ. 5 Qastroenterologiya və Hepatologiya Bölməsi, Daxili Xəstəliklər Departamenti III, Vyana Tibb Universiteti, Vyana, Avstriya.

Yazışma üçün ünvan: Gert M. Kostner, Molekulyar Biologiya və Biokimya İnstitutu, Molekulyar Tibb Mərkəzi, Qraz Tibb Universiteti, 8010 Qraz, Harrachgasse 21, Avstriya. Telefon: 43.316.380.4202 Faks: 43.316.380.9615 E-mail: [email protected]

1 Molekulyar Biologiya və Biokimya İnstitutu, Molekulyar Tibb Mərkəzi və 2 Eksperimental və Molekulyar Hepatologiya Laboratoriyası, Qastroenterologiya və Hepatologiya Bölməsi, Daxili Xəstəliklər Departamenti, Qraz Tibb Universiteti, Qraz, Avstriya. 3 Kardiologiya şöbəsi, Queensland Universiteti, Mater Adult Xəstəxanası, Brisbane, Avstraliya. 4 Metabolizm Laboratoriyası, Milli Xərçəng İnstitutu, NIH, Bethesda, ABŞ. 5 Qastroenterologiya və Hepatologiya Bölməsi, Daxili Xəstəliklər Departamenti III, Vyana Tibb Universiteti, Vyana, Avstriya.

Yazışma üçün ünvan: Gert M. Kostner, Molekulyar Biologiya və Biokimya İnstitutu, Molekulyar Tibb Mərkəzi, Qraz Tibb Universiteti, 8010 Qraz, Harrachgasse 21, Avstriya. Telefon: 43.316.380.4202 Faks: 43.316.380.9615 E-mail: [email protected]

Levak-Frank, S. məqalələrini tapın: JCI | PubMed | Google Alim

1 Molekulyar Biologiya və Biokimya İnstitutu, Molekulyar Tibb Mərkəzi və 2 Eksperimental və Molekulyar Hepatologiya Laboratoriyası, Qastroenterologiya və Hepatologiya Bölməsi, Daxili Xəstəliklər Departamenti, Qraz Tibb Universiteti, Qraz, Avstriya. 3 Kardiologiya şöbəsi, Queensland Universiteti, Mater Adult Xəstəxanası, Brisbane, Avstraliya. 4 Metabolizm Laboratoriyası, Milli Xərçəng İnstitutu, NIH, Bethesda, ABŞ. 5 Qastroenterologiya və Hepatologiya Bölməsi, Daxili Xəstəliklər Departamenti III, Vyana Tibb Universiteti, Vyana, Avstriya.

Yazışma üçün ünvan: Gert M. Kostner, Molekulyar Biologiya və Biokimya İnstitutu, Molekulyar Tibb Mərkəzi, Qraz Tibb Universiteti, 8010 Qraz, Harrachgasse 21, Avstriya. Telefon: 43.316.380.4202 Faks: 43.316.380.9615 E-mail: [email protected]

1 Molekulyar Biologiya və Biokimya İnstitutu, Molekulyar Tibb Mərkəzi və 2 Eksperimental və Molekulyar Hepatologiya Laboratoriyası, Qastroenterologiya və Hepatologiya Bölməsi, Daxili Xəstəliklər Departamenti, Qraz Tibb Universiteti, Qraz, Avstriya. 3 Kardiologiya şöbəsi, Queensland Universiteti, Mater Adult Xəstəxanası, Brisbane, Avstraliya. 4 Metabolizm Laboratoriyası, Milli Xərçəng İnstitutu, NIH, Bethesda, ABŞ. 5 Qastroenterologiya və Hepatologiya Bölməsi, Daxili Xəstəliklər Departamenti III, Vyana Tibb Universiteti, Vyana, Avstriya.

Yazışma üçün ünvan: Gert M. Kostner, Molekulyar Biologiya və Biokimya İnstitutu, Molekulyar Tibb Mərkəzi, Qraz Tibb Universiteti, 8010 Qraz, Harrachgasse 21, Avstriya. Telefon: 43.316.380.4202 Faks: 43.316.380.9615 E-mail: [email protected]

Gonzalez, F. tərəfindən məqalələr tapın: JCI | PubMed | Google Alim

1 Molekulyar Biologiya və Biokimya İnstitutu, Molekulyar Tibb Mərkəzi və 2 Eksperimental və Molekulyar Hepatologiya Laboratoriyası, Qastroenterologiya və Hepatologiya Bölməsi, Daxili Xəstəliklər Departamenti, Qraz Tibb Universiteti, Qraz, Avstriya. 3 Kardiologiya şöbəsi, Queensland Universiteti, Mater Adult Xəstəxanası, Brisbane, Avstraliya.4 Metabolizm Laboratoriyası, Milli Xərçəng İnstitutu, NIH, Bethesda, ABŞ. 5 Qastroenterologiya və Hepatologiya Bölməsi, Daxili Xəstəliklər Departamenti III, Vyana Tibb Universiteti, Vyana, Avstriya.

Yazışma üçün ünvan: Gert M. Kostner, Molekulyar Biologiya və Biokimya İnstitutu, Molekulyar Tibb Mərkəzi, Qraz Tibb Universiteti, 8010 Qraz, Harrachgasse 21, Avstriya. Telefon: 43.316.380.4202 Faks: 43.316.380.9615 E-mail: [email protected]

Trauner, M. tərəfindən məqalələr tapın: JCI | PubMed | Google Alim

1 Molekulyar Biologiya və Biokimya İnstitutu, Molekulyar Tibb Mərkəzi və 2 Eksperimental və Molekulyar Hepatologiya Laboratoriyası, Qastroenterologiya və Hepatologiya Bölməsi, Daxili Xəstəliklər Departamenti, Qraz Tibb Universiteti, Qraz, Avstriya. 3 Kardiologiya şöbəsi, Queensland Universiteti, Mater Adult Xəstəxanası, Brisbane, Avstraliya. 4 Metabolizm Laboratoriyası, Milli Xərçəng İnstitutu, NIH, Bethesda, ABŞ. 5 Qastroenterologiya və Hepatologiya Bölməsi, Daxili Xəstəliklər Departamenti III, Vyana Tibb Universiteti, Vyana, Avstriya.

Yazışma üçün ünvan: Gert M. Kostner, Molekulyar Biologiya və Biokimya İnstitutu, Molekulyar Tibb Mərkəzi, Qraz Tibb Universiteti, 8010 Qraz, Harrachgasse 21, Avstriya. Telefon: 43.316.380.4202 Faks: 43.316.380.9615 E-mail: [email protected]

Kostner, G. tərəfindən məqalələr tapın: JCI | PubMed | Google Alim

tərəfindən kodlanan lipoprotein(a) [Lp(a) yüksək plazma konsentrasiyası APOA gen] fərdin koronar arteriya xəstəlikləri, restenoz və insult kimi xəstəliklərin inkişaf riskini artırır. Təəssüf ki, artan Lp (a) səviyyələri pəhriz dəyişiklikləri və ya dərman müalicəsi ilə minimal təsirlənir. Bundan əlavə, Lp(a)-a məxsus dərmanların inkişafı Lp(a) metabolizmi haqqında məhdud biliklərə görə əngəllənmişdir. Bu tədqiqatda biz cərrahi müdaxilədən sonra əhəmiyyətli dərəcədə yüksələn plazma Lp(a) konsentrasiyaları çox aşağı olan öd yollarının maneələrindən əziyyət çəkən xəstələri müəyyən etdik. Buna uyğun olaraq, insan üçün transgenik siçanlarda ümumi öd kanallarının bağlanması APOA (tg-APOA siçanlar) plazma konsentrasiyalarını və APOA-nın qaraciyər ifadəsini azaldır. Öd turşuları tərəfindən aktivləşdirilən farnesoid X reseptorunun (FXR) xolestatik xəstələrdə və siçanlarda aşağı plazma Lp(a) səviyyələrinə cavabdeh olub-olmadığını yoxlamaq üçün tg-APOA və tg-APOA/Fxr –/– xolik turşusu olan siçanlar. FXR aktivləşdirilməsi plazma konsentrasiyalarını və insan APOA-nın qaraciyərdə tg-də ifadəsini nəzərəçarpacaq dərəcədə azaldır.APOA siçanlar lakin tg-də deyilAPOA/Fxr –/– siçan. tg-dən birincili hepatositlərin inkubasiyasıAPOA öd turşuları olan siçanların dozası asılı olaraq aşağı tənzimlənir APOA ifadə. Sonrakı təhlillər müəyyən etdi ki, nükleotidlərin –826 və –814 arasında birbaşa təkrar 1 elementi APOA promotor mənfi FXR cavab elementi kimi fəaliyyət göstərmişdir. Bu motiv həmçinin hepatosit nüvə faktoru 4α (HNF4α) ilə bağlıdır. APOA transkripsiya və FXR-nin bu motivə bağlanmaq üçün HNF4α ilə rəqabət apardığı göstərildi. Bu tapıntılar Lp(a) azaldıcı dərmanların hazırlanmasında mühüm təsir göstərə bilər.

Lipoprotein(a) [Lp(a)] insanlarda və Köhnə Dünya meymunlarında olan plazma lipoproteinidir, lakin adi laboratoriya heyvanlarında yoxdur. Plazma Lp(a) konsentrasiyaları ciddi genetik nəzarət altındadır və 1 mq/dl-dən az ilə 200 mq/dl-dən çox, median isə 8-9 mq/dl arasında dəyişir (ref. 1, 2-də nəzərdən keçirilir). Lp(a) əsasən qaraciyərdə sintez olunan sərbəst APOA-nın aşağı sıxlıqlı lipoproteinin apoB-100 ilə kovalent bağlanması nəticəsində əmələ gələn kompleks plazma lipoproteinidir (3). Uzun illərdir ki, yüksək plazma Lp(a) konsentrasiyalarının tromboaterogen xəstəliklərlə əlaqəli olduğu bilinsə də (4-6), böyük kohortlardan əldə edilən son sübutlar nəhayət səbəb əlaqəsini təsdiqlədi (7-11). Buna görə də, konsensus hesabatında, Avropa Ateroskleroz Cəmiyyəti ürək-damar xəstəlikləri riski orta və yüksək olan insanlarda Lp(a) üçün skrininqi tövsiyə etdi, burada Lp(a) üçün arzu olunan həddi 50 mq/dl-dən az müəyyən edildi. ( 12 ).

Lp(a)-nın trombo-aterogen xüsusiyyətləri də transgen siçanlarda yaxşı sənədləşdirilmişdir (13, 14). Lp(a)-nın patomexanizmlərinə bir neçə hemostatik yollar aid edilmişdir (15, 16). Yüksək aterogenliyinə görə, Lp(a) səviyyələri yüksəlmiş fərdləri dərman və ya pəhriz (16) ilə müalicə etmək üçün bir neçə cəhdlər edilmiş, lakin müvəffəqiyyət əldə edilməmişdir. Nikotinik turşu və onun törəmələri Lp(a) səviyyəsini 30%-ə qədər aşağı salsa da, tez-tez yan təsirlər göstərdiyi üçün geniş istifadə olunmur. Buna görə də, bu günə qədər yüksək plazma Lp(a) səviyyələri olan şəxslərin müalicəsi üçün təhlükəsiz dərman preparatı mövcud deyil və yeni dərmanların inkişafı həm Lp(a) biosintezi, həm də katabolizm haqqında ətraflı məlumatın olmaması səbəbindən maneə törədir.

İnsanlarda əvvəlki dövriyyə tədqiqatları göstərdi ki, plazma Lp(a) səviyyələri onun biosintez sürəti ilə güclü korrelyasiya edir, lakin fraksiya katabolik sürəti ilə deyil (17, 18). Beləliklə, plazma Lp(a) səviyyələrinə nəzarət etmək üçün hər hansı cəhd APOA biosintezinə müdaxiləyə diqqət yetirməlidir. Bu, CMV promotorunun nəzarəti altında siçanlarda ifadə olunan N-terminal APOA fraqmentinin plazma səviyyələrinin demək olar ki, sıfıra endirildiyi antisens strategiyalarından istifadə edərək in vivo tədqiqatlar tərəfindən dəstəklənmişdir (19). Ancaq kiçik molekullu dərmanlar hələ mövcud deyil.

Farnesoid X reseptoru (FXR, həmçinin NR1H4 kimi tanınır) öd turşusu ilə aktivləşdirilmiş reseptordur və liqandla aktivləşdirilmiş transkripsiya faktorlarının nüvə reseptor super ailəsinə aiddir (20-23). FXR əsasən qaraciyər, bağırsaq, böyrək və adrenal bezlərdə ifadə edilir. FXR retinoid X reseptoru (RXRα, həmçinin NR2B1 kimi tanınır) ilə heterodimerləşir, adətən, lakin müstəsna olaraq ters çevrilmiş təkrar-1 (IR-1) olmayan FXR cavab elementlərinə (FXRE) bağlanır və hədəf genlərin transkripsiyasını tənzimləyir (24). Bənzər əsas ardıcıllığa malik birbaşa təkrar (DR) monomer və ya heterodimer kimi FXR-nin bağlanması üçün də uyğundur (24 – 27). FXR öd turşusu, xolesterin, lipoprotein və trigliserid mübadiləsində mühüm rol oynayır. Qaraciyər FXR-nin aktivləşdirilməsi lipid mübadiləsində iştirak edən bir çox qaraciyər genlərinin ifadəsini modullaşdırır. Tədqiqatlar istifadə edərək Fxr –/– siçanlar bu nüvə reseptorunun xolesterol və öd turşusu homeostazının saxlanmasında əhəmiyyətini göstərmişlər (28, 29).

Hazırkı araşdırmada həmin transkripsiyanı bildiririk APOA gen insanın –826-bp bölgəsində yerləşən mənfi nəzarət elementinə bağlanan FXR-nin güclü nəzarəti altındadır. APOA təşviqatçı. FXR-nin hepatosit nüvə faktoru 4α-vasitəçiliyi (HNF4α-vasitəçiliyi) (HNF4α da NR2A1 kimi tanınır) aktivləşməsinə mane olduğu aşkar edilmişdir. APOA transkripsiya.

Yüksək öd turşusu səviyyələri insanlarda plazma Lp(a) səviyyələrini kəskin şəkildə azaldır. Biz davamlı olaraq müxtəlif klinik şəraitdə müşahidə etmişik ki, obstruktiv sarılıqdan əziyyət çəkən xəstələrdə plazma Lp(a) çox aşağı və ya hətta aşkar edilməyən səviyyələr nümayiş etdirilir. Bunu daha sistemli şəkildə öyrənmək üçün obstruktiv sarılığı olan xəstələr bilirubin, lipoprotein X (LP-X) və plazma öd turşusunun konsentrasiyası kimi xolestaz markerləri üçün təhlil edilmiş və nəticələr Lp(a) səviyyələri ilə əlaqələndirilmişdir. Əlavə Cədvəl 1 (əlavə material bu məqalə ilə onlayn olaraq mövcuddur: 10.1172/JCI45277DS1) pankreas, öd kisəsi və ya öd kanalı xərçəngi səbəbiylə öd yollarının obstruksiyası olan 20 xəstənin nəticələrini sadalayır. Bundan əlavə, anadangəlmə öd yollarının atreziyası olan 1 xəstə və xoledoxolitiazlı 5 xəstə daxil edilmişdir. Bütün xəstələrdə yüksək plazma bilirubinin konsentrasiyası (316 ± 48 μmol/l) və plazma LP-X (370 ± 47,7 mq/dl) müsbət olub. Qeyd edək ki, xəstələrin plazmasında ümumi öd turşusu səviyyəsi 98,9 ± 9,2 μmol/l olub ki, bu da sağlam insanlarla müqayisədə 10 dəfədən çox yüksək olub (Şəkil 1A). Bu xəstələrin 20-dən 13-də terapiyadan əvvəl plazma Lp(a) konsentrasiyası 1 mq/dl-dən az olmuşdur ki, bu da xüsusi analizin aşkarlama həddidir. Qalan 7 xəstədə Lp(a) səviyyəsi çox aşağı idi APOA izoform (K-IV təkrarlanır). Öd yollarının obstruksiyasının uğurlu cərrahi və ya endoskopik müalicəsindən sonra bilirubin, LP-X və ümumi öd turşusu səviyyələri normallaşdırıldı və Lp(a) konsentrasiyaları müvafiq olan sağlam nəzarətçilərinkinə uyğun gələn səviyyələrə əhəmiyyətli dərəcədə yüksəldi. APOA izoformalar. Orta plazma Lp(a) səviyyələri terapiyadan əvvəl 2,7 ± 1,1 mq/dl, müalicədən sonra isə 20,3 ± 4,4 mq/dl olmuşdur (Şəkil 1B).

Obstruktiv sarılığı olan xəstələrdə aşağı plazma Lp(a) səviyyəsi. Müxtəlif etiologiyalı obstruktiv sarılıqdan əziyyət çəkən 20 xəstədən alınan plazma nümunələri (A) ümumi öd turşuları və (B) Lp(a), cərrahi və ya endoskopik müalicədən əvvəl və sonra. Dəyərlər orta ± SEM kimi ifadə edilir. Ətraflı məlumat üçün Əlavə Cədvəl 1-ə baxın.

Yüksək öd turşusu səviyyələri olan xolestatik siçan modeli APOA-nın çox aşağı plazma və qaraciyər ifadəsini nümayiş etdirir. Obstruktiv xolestazın plazma səviyyələrinə və qaraciyər APOA ifadəsinə təsirini müəyyən etmək üçün insan üçün transgenik siçan APOA (tg-APOA siçanlar) və tg-APOA Fxr çatışmazlığı olan siçanlar (tg-APOA/Fxr –/– siçanlar) 3 gün ərzində ümumi öd yollarının bağlanması (CBDL) ilə öd yollarının tıxanmasına məruz qalmışdır. tg-də CBDLAPOA siçanlar serum qaraciyər fermentlərinin (Əlavə Cədvəl 2), ümumi öd turşularının və bilirubinin (Şəkil 2, A və B) əhəmiyyətli dərəcədə artması ilə nəticələndi. tg-də endogen öd turşularının toplanmasıAPOA siçanlar plazma APOA səviyyələrinin 87% (Şəkil 2C) və qaraciyərin kəskin azalmasına səbəb oldu. APOA mRNT ifadəsi 98% (Şəkil 2D). Tg-də CBDLAPOA/Fxr –/– siçanlar, iltihab və qaraciyər zədələnməsi ilə bağlı ola bilən plazma APOA-nın 15% və qaraciyər mRNT-nin 19% (Əlavə Şəkil 1) kiçik, lakin ölçülə bilən azalması göstərdi. Nəticə olaraq, siçan və insan xolestazında aşkar edilən aşağı APOA səviyyələri bunu irəli sürdü APOA ifadəsi in vivo öd turşuları ilə tənzimlənir.

Plazma səviyyələrində kəskin azalma və qaraciyər mRNA ifadəsi APOA xolestazın siçan modelində. tg-APOA siçanlar CBDL tərəfindən öd yollarının tıxanmasına məruz qaldılar (n = hər qrup üçün 3) və ya saxta əməliyyat (n = hər qrup üçün 4) 3 gün ərzində. (AB) Ümumi öd turşuları və bilirubin zərdabda ölçüldü. Məlumatlar orta ± SD kimi təqdim olunur. ***P ≤ 0,001, saxta ilə işləyən siçanlar ilə müqayisədə. (C) APOA-nın plazma səviyyələri DELFIA tərəfindən ölçüldü və orta ± SD (***) kimi ifadə edildi.P ≤ 0.001). (D) Qaraciyər APOA mRNT səviyyələri real vaxt rejimində siklofilinə normallaşdırılan kəmiyyət PCR ilə təhlil edildi və saxta idarə olunan siçanlara nisbətən ifadə edildi. Nəticələr orta ± SEM (***) təmsil edirP ≤ 0.001).

Xolik turşusu ilə qidalanma transgen APOA siçanlarında plazma APOA konsentrasiyalarını və qaraciyər APOA ifadəsini azaldır. İnsanın tənzimlənməsini öyrənmək APOA qeyri-xolestatik modeldə öd turşuları ilə gen ifadəsi, tg-APOA və tg-APOA/Fxr –/– insanı ifadə edən siçanlar APOA gen 5 gün ərzində ya normal çov pəhrizi (nəzarət) və ya 0,2% xolik turşusu (CA) (ağırlıq/ağırlıq) ilə əlavə edilmiş çov pəhrizi ilə qidalanıb. Nəzarət və müalicə olunan qruplar arasında bədən çəkisi və ya qida qəbulunda heç bir dəyişiklik müşahidə edilməmişdir (məlumatlar göstərilmir). Plazma ümumi xolesterol və trigliserid səviyyələri tg-də azaldı.APOA CA ilə qidalanan siçanlar, lakin tg-də dəyişməz qaldılar.APOA/Fxr –/– siçanlar (Əlavə Şəkil 2). 0,2%-CA əlavəsi tg-də plazma APOA səviyyələrinin əhəmiyyətli dərəcədə 72% azalmasına səbəb oldu.APOA siçanlar (Şəkil 3A). Plazma APOA səviyyəsinin azalmasının azalma ilə bağlı olub olmadığını qiymətləndirmək APOA Qaraciyərdə mRNA səviyyələri, real vaxtda kəmiyyət PCR analizi edildi. APOA CA ilə qidalanan tg-nin qaraciyərlərində mRNT səviyyələri əhəmiyyətli dərəcədə azalmışdır.APOA siçanlar (Şəkil 3B). Qaraciyər homogenatlarının Western blot analizi təsdiqlədi ki, bu repressiya tg-də CA-nın qidalanması zamanı protein səviyyəsində də baş verir.APOA siçanlar (Şəkil 3C). tg-dəAPOA/Fxr –/– siçanlar isə plazma APOA konsentrasiyaları (Şəkil 3D), qaraciyər APOA mRNA səviyyələri (Şəkil 3E) və protein səviyyələri (Şəkil 3F) nəzarət və CA ilə müalicə olunan siçanlarda müqayisə edilə bilər. Birlikdə götürüldükdə, bu məlumatlar göstərir ki, insan APOA-nın həm plazma səviyyələri, həm də qaraciyər ifadəsi tg-də CA qidalanması ilə aşağı tənzimlənir.APOA siçanlar FXR-dən asılı olaraq.

CA plazma səviyyəsini və qaraciyərin ifadəsini azaldır APOA tg-dəAPOA siçanlar lakin tg-də deyilAPOA/Fxr –/– siçan. tg-APOA siçan (n = qrup başına 8) və tg-APOA/Fxr –/– siçan (n = hər qrup üçün 8) insan APOA-nı ifadə edən 0,2% CA (ağırlıq/ağırlıq) 5 gün ərzində normal çovda qarışdırılmış qidalandı. Nəzarət siçanları normal gəmirici yemi qəbul etdilər. (AD) APOA-nın plazma səviyyələri DELFIA tərəfindən ölçüldü və orta ± SD (**) kimi ifadə edildi.P ≤ 0.01). (BE) Siçan qaraciyəri APOA mRNT səviyyələri real vaxtda kəmiyyət PCR ilə təhlil edildi və siklofilinə normallaşdırıldı və nəzarət siçanlarına nisbətən ifadə edildi. Nəticələr orta ± SEM (***) təmsil edirP ≤ 0.001). (CF) Qaraciyər toxumasından zülal ekstraktlarında APOA səviyyələrinin Western blot analizi və densitometrik kəmiyyəti (nəzarət orqanlarına nisbətən orta ± SD kimi ifadə edilir **P ≤ 0,01). Gen ifadə profili təhlil edildi (G) tg-APOA siçanlar və (H) tg-APOA/Fxr –/– real vaxt kəmiyyət PCR ilə siçanlar. Nəzarət siçanlarında mRNT ifadəsi ixtiyari olaraq 1-ə təyin edildi və siklofilinə normallaşdırıldı. Nəticələr orta ± SEM (***) təmsil edirP ≤ 0.001, **P ≤ 0.01, *P < 0,05).

Daha sonra, 5 günlük tg qidalanmasından sonra öd turşusu və xolesterol metabolizmasında iştirak edən məlum FXR hədəf genlərinin qaraciyər ifadəsini profilləşdirdik.-APOA və tg-APOA/Fxr –/– CA ilə siçanlar (Şəkil 3, G və H). Gözlənildiyi kimi, tg-nin CA müalicəsiAPOA siçanlar hər ikisinin güclü inhibəsinə səbəb oldu Cyp7a1Cyp8b1 (30 - 32), kiçik heterodimer partnyorunun 2,3 qat yuxarı tənzimlənməsi (Şp, həmçinin NR0B2 kimi tanınır ( 33 ) və induksiyası Bsep. Hepatik mRNT ifadəsində heç bir dəyişiklik müşahidə edilməmişdir Lrh1Hnf4a. Fgf15 İleumdakı mRNT 2,8 dəfə yuxarı tənzimləndi (34). CA ilə qidalanma qaraciyər ifadəsini dəyişmədi Cyp3a11, tg-də hamilə X reseptorunun (NR1I2 kimi tanınan PXR) hədəf geniAPOA siçanlar, PXR-nin pəhrizdə 0,2% CA ilə aktivləşdirilmədiyini göstərir. Bunun əksinə olaraq, CA müalicəsi tg-də FXR hədəf genlərinin mRNA səviyyələrinə təsir göstərməmişdir.APOA/Fxr –/– siçanlar, hələ Cyp3a11 ifadəsi induksiya edilmişdir (35, 36).

Safra turşuları qaraciyərdə iltihaba səbəb ola bilər və qaraciyərin zədələnməsinə səbəb ola bilər (37). Üstəlik, insanlarda və siçanlarda xolestaz yüksək iltihabla xarakterizə olunur (38). Buna görə də, bir neçə proinflamatuar genin qaraciyər ifadəsini öyrəndik. 0,2%-CA ilə qidalanma proinflamatuar sitokinlərin ifadə səviyyələrini dəyişməyib. Il6, Il1b, və Tnfa tg ilə-APOA siçanlar (Əlavə Şəkil 3A), halbuki Il6 ifadəsi tg-də 2,6 dəfə artmışdır-APOA/Fxr –/– siçanlar (Əlavə Şəkil 3B). Birlikdə götürdükdə, bu nəticələr öd turşularının repressiya etdiyini göstərdi APOA bir FXR vasitəçiliyi ilə ifadə.

CA və GW4064 birincil hepatositlərdə insan APOA gen ifadəsini azaldır. FXR-nin qaraciyərə inhibitor təsirinin birbaşa mexanizmini daha da öyrənmək APOA ifadəsi, sonra FXR agonistlərinin təsirini öyrəndik APOA siçan birincil hepatositlərində ifadə. Bu məqsədlə ilkin hepatositlər tg-dən təcrid edilmişdir.APOA siçanlar və təbii FXR liqand CA-nın müxtəlif konsentrasiyaları ilə inkubasiya edilmişdir. Real vaxt kəmiyyət PCR ilə mRNT səviyyələrinin təhlili dozadan və zamandan asılı olaraq əhəmiyyətli dərəcədə azalma aşkar etdi. APOA transkripsiya səviyyələri, transkripsiya effektini göstərir (Şəkil 4, A və B). Western blot analizi təsdiq etdi ki, bu CA vasitəçiliyi ilə repressiya zülal səviyyəsində də baş verir (Şəkil 4C). Hüceyrə canlılığı tripan mavisi istisna testi ilə qiymətləndirilib, CA-nın bütün konsentrasiyalarının hüceyrələr tərəfindən yaxşı tolere edildiyi aşkar edilib (məlumatlar göstərilməyib).

FXR agonistləri aşağı tənzimləyir APOA birincili siçan hepatositlərində dozadan və zamandan asılı olaraq gen ifadəsi. (A) Tg-dən ilkin siçan hepatositləriAPOA siçanlar 24 saat ərzində artan CA (50, 100 və 200 μM) və ya vasitə (nəzarət) konsentrasiyası ilə inkubasiya edilmişdir. APOA mRNT səviyyələri real vaxt kəmiyyət PCR ilə təhlil edildi. Bu məlumatlar orta ± SEM kimi təqdim olunur (**P ≤ 0.01, *P < 0,05). (B) İlkin siçan hepatositləri CA (200 μM) və ya vasitə ilə 12, 24 və 48 saat ərzində inkubasiya edilmişdir. APOA mRNT səviyyələri real vaxt kəmiyyət PCR ilə ölçüldü. Nəticələr 3 müstəqil təcrübənin orta ± SEM-ni təmsil edir (**P ≤ 0.01). (C) CA-nın artan konsentrasiyası ilə 24 saat ərzində müalicə olunan hepatositlərin bütün hüceyrə lizatlarında APOA ifadəsinin vestern blot və densitometrik analizləri (nəzarət orqanlarına nisbətən orta ± SD kimi ifadə edilir*P < 0,05). (D) Birincil hepatositlər 24 saat ərzində GW4064 (5 μM) ilə müalicə olundu və analiz edildi APOA Real vaxt kəmiyyət PCR ilə mRNA səviyyələri. Bu məlumatlar 3 müstəqil təcrübənin orta ± SEM kimi təqdim olunur (**P ≤ 0.01). (E) 24 saat ərzində GW4064 (5 μM) ilə müalicə olunan hepatositlərdən alınan bütün hüceyrə lizatlarında APOA ifadəsinin Western blot və densitometrik analizləri (nəzarət orqanlarına nisbətən orta ± SD kimi ifadə edilir **P ≤ 0.01).

Öd turşuları digər siqnal ötürmə yollarını aktivləşdirməklə FXR-dən asılı olmayan təsirlər göstərə bildiyindən (39, 40), biz əlavə olaraq sintetik qeyri-steroid FXR agonist GW4064-ün təsirini sınaqdan keçirdik. APOA gen ifadəsi. Birincil hepatositlərin 24 saat ərzində 5 μM GW4064 ilə müalicəsi onların əhəmiyyətli dərəcədə azalması ilə nəticələndi. APOA mRNA (Şəkil 4D) və zülal səviyyələri (Şəkil 4E) nəqliyyat vasitəsi ilə müalicə olunan nəzarət hüceyrələri ilə müqayisədə. Bundan əlavə, biz CA və GW4064 ilə müalicədən sonra nəzarət FXR hədəf genlərinin ifadə səviyyələrini ölçdük və hər iki ligandın artdığını aşkar etdik. Şp və nəzərəçarpacaq dərəcədə azalmışdır Cyp7a1Apoa1 mRNA səviyyələri (Əlavə Şəkil 4, A və B).

Ümumilikdə, bu nəticələr göstərir ki, həm təbii, həm də sintetik FXR agonistləri insanı tənzimləyir APOA transkripsiya mexanizmi vasitəsilə mədəni siçan birincil hepatositlərində ifadə.

İnsan APOA promouterində FXRE-nin xəritəsi.FXR vasitəçiliyi ilə inhibitor təsiri üçün birbaşa sübut təmin etmək APOA promotor və müvafiq promotor element(lər)i, insanın 2 kb-lik fraqmentini daha da müəyyən etmək APOA promotor (-1,952 bp-dən +52 bp-ə qədər, burada hAPOA –1,952/+52 promotor) pGL3-lusiferaza reportyor plazmidinə klonlaşdırıldı (Şəkil 5A). Bundan əlavə, Şəkil 5D-də göstərildiyi kimi bir sıra 5′ silmə konstruksiyaları yaradıldı. Keçici transfeksiyalar h ilə HepG2 hüceyrələrində aparıldıAPOA FXR və FXR agonistlərinin olmaması və ya olması halında –1,952/+52 promotor quruluşu. Təkcə FXR promotor fəaliyyətinin 29% azalması ilə nəticələndi və bu təsir chenodeoxycholic acid (CDCA) (63%) əlavə edilərək daha da gücləndirildi (Şəkil 5B). Eyni şəkildə, FXR və GW4064 ilə inkubasiya da h.APOA –1952/+52 promouter 57% (Şəkil 5C). FXR həddindən artıq ifadəsi olmadıqda, hAPOA –1952/+52 promotoru yalnız CDCA və ya GW4064 tərəfindən 25% və ya daha az inhibə edilmişdir. Bu azalma çox güman ki, endogenin aktivləşməsi nəticəsində baş verib FXR HepG2 hüceyrələrində ifadə edilir (27).

Öd turşuları və qeyri-steroid FXR agonisti GW4064 insanı aşağı tənzimləyir APOA FXR vasitəsilə promotor fəaliyyəti. (A) Tam metrajlı h. sxemiAPOA -1,952/+52 promotorla idarə olunan lusiferaza reportyor sistemi. (BC) HepG2 hüceyrələri h ilə transfeksiya edilmişdirAPOA pcDNA3 (nəzarət) və ya FXR ifadə vektorunun (150 ng) iştirakı ilə –1,952/+52 promotor reportyor plazmid (150 ng). Hüceyrələr daha sonra 36 saat ərzində CDCA (100 μM), GW4064 (500 nM) və ya vasitə ilə müalicə olundu. Dəyərlər daxili nəzarət β-qalaktosidaza üçün normallaşdırılır və faizlə ifadə edilir. Transfeksiyalar üç nüsxədə aparıldı və hər təcrübə ən azı 3 dəfə təkrarlandı. (D) İnsanın silmə konstruksiyalarının sxemi APOA lusiferaza müxbir analizində istifadə edilən promotor. HepG2 hüceyrələri göstərilən insanla transfeksiya edilmişdir APOA pcDNA3 boş və ya FXR ifadə vektorunun (150 ng) iştirakı ilə promotor reportyor plazmidləri (150 ng). Hüceyrələr daha sonra 36 saat ərzində CDCA (100 μM) və ya vasitə ilə müalicə olundu. Dəyərlər daxili nəzarət β-qalaktosidaza fəaliyyəti üçün normallaşdırılır. (E) Vəhşi tipli və mutant ardıcıllığı göstərən sxem. Mutasiyalar qalın kiçik hərflərlə göstərilir. Altını çizilmiş hərflər DR-1 elementini müəyyənləşdirir. (F) İnsanın mutasiya analizi APOA təşviqatçı. HepG2 hüceyrələri vəhşi tipli və mutant (M1, M2) insanla transfeksiya edilmişdir APOA pcDNA3 boş və ya FXR ehtiva edən ifadə vektorunun (150 ng) iştirakı ilə promotor reportyor plazmidlər. Hüceyrələr daha sonra 36 saat ərzində CDCA (100 μM) və ya vasitə ilə müalicə olundu. Dəyərlər β-qalaktosidaza aktivliyinə normallaşdırılır və faizlə ifadə edilir. Məlumatlar orta ± SD (**) kimi təqdim olunurP ≤ 0.01, *P < 0,05).

Endojenin qarşısını almaq üçün FXR-vasitəçiliklə əks əlaqənin inhibə edilməsi, qeyri-hepatik hüceyrə xətti olan COS-7 hüceyrələrində keçici transfeksiya təcrübələri aparılmışdır. FXR-nin olmaması və ya olması halında COS-7 hüceyrələrinin transfeksiyası hAPOA -1,952/+52 promotor fəaliyyəti 24%, bu təsir CDCA (43%) tərəfindən əhəmiyyətli dərəcədə artırılmışdır (Əlavə Şəkil 5). Bu təcrübələr göstərdi ki, FXR-nin ektopik ifadəsi və CDCA-nın fizioloji konsentrasiyası rezeksiyanın qarşısını almaq üçün tələb olunur. APOA qeyri-hepatik hüceyrələrdə promotor fəaliyyəti.

ildən Şp in vivo və in vitro CA müalicəsi ilə induksiya edildi, biz sonradan öyrəndik APOA SHP ifadə plazmidinin artan konsentrasiyası ilə hüceyrələrin kotransfeksiyası zamanı promotor fəaliyyəti. Təəccüblüdür ki, SHP aşağı düşmədi APOA promotor fəaliyyəti, lakin onu daha da gücləndirdi (Əlavə Şəkil 6). Birlikdə götürdükdə, bu nəticələr FXR-nin tənzimləyə biləcəyini göstərdi APOA birbaşa və SHP-dən asılı olmayan şəkildə promouter fəaliyyəti.

Sonra, FXR-nin müşahidə olunan təsirlərinə cavabdeh olan promotor elementləri müəyyən etmək üçün HepG2 hüceyrələri insanın 5′ silmə konstruksiyaları ilə transfeksiya edildi. APOA FXR və/və ya CDCA olmadıqda və ya mövcud olduqda promotor. Həm –1,446-bp, həm də –857-bp konstruksiyalar üçün azaldılmış təşviqat fəaliyyəti qeyd edildi (Şəkil 5D). Bununla belə, repressiya –757-, –657-, –477- və –148-bp promouter konstruksiyaları üçün yüngülləşdirildi, bu da göstərir ki, regionun –857-dən –757bp-ə qədər insan APOA promotorda müşahidə olunan öd turşusu reaksiyasına cavabdeh ola biləcək potensial mənfi FXRE var.

Xüsusilə, silico Matinspector promotor analizində (41) və NUBIScan alqoritmində (42) -826 və -814 nukleotidləri arasında yerləşən DR-1 elementinin mövcudluğunu təklif etdi. Əvvəlki tədqiqatlar artıq göstərmişdir ki, DR-1 elementi FXRE kimi fəaliyyət göstərə bilər (24, 43, 44).

Bu DR-1 saytının FXR-dən asılı repressiyaya vasitəçilik edə biləcəyini yoxlamaq üçün APOA promotor, biz tammetrajlı h kontekstində mutasiyalar təqdim etdikAPOA –1,952/+52 promotor (WT) və Şəkil 5E-də göstərildiyi kimi 2 mutant konstruksiya (M1 və M2) yaratdı. Bu saytın mutasiyası (M2) FXR vasitəçiliyi ilə repressiyanı tamamilə ləğv etdi APOA promotor fəaliyyəti (Şəkil 5F), FXR-nin DR-1 elementinin ikinci yarım sahəsinə bağlanmasını göstərir.

Birlikdə götürdükdə, bu nəticələr göstərir ki, -826 və -814 nukleotidləri arasında yerləşən DR-1 sahəsi FXR-nin insanı sıxışdırdığı mənfi cavab elementidir. APOA təşviqat fəaliyyəti.

FXR EMSA-da APOA promouterinin DR-1 saytına bağlanır. DR-1 elementinin insanın -826-bp bölgəsində olduğuna dair əlavə sübutlar təqdim etmək APOA promotor FXRE kimi fəaliyyət göstərə bilər, gel sürüşdürmə analizləri aparılmışdır. Müsbət nəzarət kimi Consensus IR-1 probu istifadə edilmişdir. FXR həm RXR olmadıqda (Şəkil 6A, zolaq 3) həm də mövcud olduqda (Şəkil 6A, zolaq 4) etiketli IR-1 zondunu bağladı. Bunun əksinə olaraq, FXR vəhşi tipli DR-1 elementi (DR-1 WT) (Şəkil 6A, zolaqlar 7 və 8) olan, lakin mutasiyaya uğramış DR-1 elementini (DR) daşıyan zonda deyil, radio ilə işarələnmiş zondla monomer kimi bağlıdır. -1 M2) (Şəkil 6A, zolaqlar 11 və 12). FXR-DNT kompleksinin formalaşması xüsusi olaraq soyuq DR-1 WT zondu (Şəkil 6B, zolaqlar 3-5) ilə yarışdı, halbuki DR-1 M2 zondu rəqabət aparmadı (Şəkil 6B, zolaq 6). FXR-nin DR-1 WT zonduna bağlanması soyuq IR-1 zondu (Şəkil 6B, zolaq 7) ilə də rəqabət apardı (Şəkil 6B, zolaq 7), xüsusilə soyuq IR-1 və soyuq DR-1 WT zondları etiketli DR üçün oxşar effektivliklə yarışdı. -1 WT oliqosu. Bu nəticələr FXR-nin xüsusi olaraq insanın DR-1 sahəsinə bağlandığını göstərdi APOA təşviqatçı.

FXR insanın DR-1 elementinə bağlanır APOA monomer kimi promotor. (A) EMSA-lar radio-etiketli IR-1 konsensus FXRE (zolaqlar 1-4), DR-1 WT (zolaqlar 5-8) və DR-1 M2 (zolaqlar 9-12) zondları ilə in vitro transkripsiya edilmiş/tərcümə edilmiş RXR (zolaqlar) ilə yerinə yetirilmişdir. 2, 6 və 10), FXR (zolaq 3, 7 və 11), həm RXR, həm də FXR (zolaq 4, 8 və 12) və ya göstərildiyi kimi proqramlaşdırılmamış retikulosit lizat (1, 5 və 9 zolaqları). (B) Radioaktiv etiketli DR-1 WT zondunda rəqabət EMSA-ları göstərilən soyuq DR-1 WT-nin (3-5-ci zolaqlar) 50 qat, 100 qat, 200 qat molar artıqlığı və soyuq DR-nin 50 qat molar artıqlığı əlavə edilməklə həyata keçirilmişdir. -1 M2 (zolaq 6) və IR-1 (zolaq 7) zondları. Nömrələmə lentlərin nisbi intensivliyini göstərir.

FXR HNF4α DR-1 elementinə bağlanmaq üçün yarışır. DR-1 elementlərinin HNF4α cavab elementləri kimi fəaliyyət göstərdiyi göstərilmişdir (45). tənzimləməni araşdırmaq məqsədi ilə APOA HNF4α ilə gen ifadəsi, biz həddindən artıq ifadə etdik HNF4α-nın mədəni əsas hepatositlərdə və insanın ifadəsini tədqiq etdi APOA gen. Şəkil 7A-da göstərildiyi kimi, adenovirusun vasitəçiliyi ilə həddindən artıq ifadə HNF4tg-dən siçan birincil hepatositlərində αAPOA siçanlar dozadan asılı olaraq ifadəsini induksiya etdi APOA mRNA səviyyələri LacZ ilə transfeksiya edilmiş hüceyrələrlə müqayisədə.

Hepatosit nüvə faktoru HNF4α həddindən artıq ifadəsinin insana təsiri APOA. (A) İlkin siçan hepatositləri ya β-qalaktosidaza (Ad-LacZ) üçün kodlaşdıran adenovirusla, ya da insan HNF4A (Ad-HNF4α). Ümumi RNT çıxarıldı və gen ifadəsi real vaxt kəmiyyət PCR ilə ölçüldü. Məlumatlar orta ± SEM-i təmsil edir. (**P ≤ 0.01). (B) HepG2 hüceyrələri h ilə transfeksiya edilmişdirAPOA HNF4α ifadə vektorunun artan miqdarının mövcudluğunda –1,952/+52 reportyor plazmid (150 ng). Dəyərlər orta ± SD (**) ifadə edirP ≤ 0.01). (C) HepG2 hüceyrələri h ilə transfeksiya edilmişdirAPOA FXR və HNF4α varlığında və ya olmamasında –1,952/+52 reportyor plazmidi. Hüceyrələr daha sonra 36 saat ərzində CDCA (100 μM) və ya vasitə ilə müalicə olundu. Dəyərlər daxili nəzarət β-qalaktosidaza üçün normallaşdırılır və faizlə ifadə edilir. Dəyərlər orta ± SD (**) ifadə edirP ≤ 0.01, *P < 0,05). (D) HNF4α insanda DR-1 motivinə bağlanır APOA təşviqatçı. In vitro transkripsiya edilmiş/tərcümə edilmiş HNF4α (zolaqlar) istifadə edən son etiketli DR-1 WT zondlu EMSA-lar 2). Rəqabət təhlili göstərilən soyuq DR-1 WT zondunun 50 qat (3-cü zolaq) və 100 qat (zolaq 4) molar artıqlığını əlavə etməklə həyata keçirilmişdir. Altını çizilmiş hərflər DR-1 elementini göstərir. (E) tg-APOA siçanlara 24 saat ərzində normal chow və ya 0,2% CA chow verildi və qaraciyərlər ChIP analizləri üçün toplandı. ChIP analizi üçün kəsilmiş xromatin göstərilən antikorlarla immunopresipitasiya edilmişdir. Son DNT ekstraksiyaları distal bölgəni və DR-1 motivini əhatə edən primer cütlərindən istifadə edərək PCR ilə gücləndirildi. APOA gen promotoru. FXR/RXR bağlanması üçün müsbət nəzarət kimi Şp gen promotoru PCR ilə gücləndirildi.

Sonra, HNF4α həddindən artıq ifadəsinin h aktivliyinə təsirini öyrəndikAPOA –1,952/+52 promouter. Şəkil 7B-də göstərildiyi kimi, HepG2 hüceyrələrində HNF4α-nın həddindən artıq ekspressiyası dozadan asılı olaraq insanı aktivləşdirdi. APOA təşviqatçı. Bununla belə, FXR və/və ya CDCA müalicəsi ilə əlavə kotransfeksiya HNF4α-vasitəçili transaktivasiyanı ləğv etdi (Şəkil 7C). Bu təsir HNF4α cavab elementinin (DR-1) FXR tərəfindən tutulması ilə bağlı ola bilər. HNF4α vasitəçiliyi ilə hAPOA –1,952/+52 promotoru, həmçinin nə FXR, nə də HNF4α ifadə etməyən qeyri-hepatik hüceyrə xəttində, COS-7-də müşahidə edilmişdir. Təkcə FXR ilə və ya FXR və CDCA ilə kotransfeksiya HNF4α transaktivasiyasını əhəmiyyətli dərəcədə inhibə etdi (Əlavə Şəkil 5), FXR-nin DR-1 bağlama motivi üçün HNF4α ilə rəqabət apardığını göstərir. Daha sonra HNF4α-nın insanın –826-bp bölgəsindəki DR-1 elementinə bağlanıb-bağlanmadığını yoxlamaq üçün hərəkətliliyin dəyişməsi analizi həyata keçirdik. APOA təşviqatçı. HNF4α DR-1 WT olan radioetiketli zondla bağlandı və zülal-DNT kompleksi xüsusi olaraq soyuq etiketsiz WT zondu ilə rəqabət apardı (Şəkil 7D).

Birlikdə götürüldükdə, bu nəticələr göstərir ki, -826 bp-də olan bu cavab elementi bazal səviyyədə HNF4α tərəfindən tutula bilər, öd turşusunun aktivləşdirilməsi isə bu sahənin FXR tərəfindən tutulmasına səbəb olur.

FXR-nin DR-1 elementi ilə qarşılıqlı əlaqəsini daha da təsdiqləmək üçün APOA promotor, in vivo ChIP təcrübələri tg-dən təcrid olunmuş qaraciyər toxuması ilə aparılmışdır.APOA siçanlar 24 saat ərzində normal çovla və ya 0,2% CA olan çov ilə qidalanırlar (Şəkil 7E). Nəzarət qrupunda HNF4α-ya qarşı antikorlar DR-1 elementini (–826-dan –814-bp bölgəsinə) əhatə edən DNT-ni çökdürdü. APOA təşviqatçı. Əksinə, 0,2%-CA qidalanma bu cavab elementinin RXR olmadan tək FXR tərəfindən tutulmasına səbəb oldu. Mənfi nəzarət kimi, uyğun olmayan anti-IgG antikoru ilə çökdürülmüş ekvivalent miqdarda xromatin heç bir siqnal ilə nəticələnmədi. Eyni DNT nümunələri, distal bölgəni əhatə edən primerlərdən istifadə etməklə PCR gücləndirildi APOA promotor, lakin heç bir siqnal müşahidə edilmədi, halbuki 0,2%-CA qidalanma həm FXR, həm də RXR-nin doluluğunu artırdı. Şp təşviqatçı.

Birlikdə götürdükdə, bu nəticələr sübut edir ki, DR-1 elementi insanın –826-dan –814-bp bölgəsində APOA promotor FXR repressiyasına vasitəçilik edə bilər APOA FXR və HNF4α arasında rəqabət vasitəsilə transkripsiya (Əlavə Şəkil 7).

Prospektiv və epidemioloji tədqiqatların meta-analizləri yüksək plazma Lp(a) səviyyələrinin ürək işemik xəstəlikləri və insult riskinin artması ilə əlaqəsini nümayiş etdirdi (7-11). Lp(a) səbəbli olaraq miokard infarktı riskinin artması ilə əlaqələndirilir və plazmada Lp(a) səviyyələri 30 mq/dl-dən 2,3 dəfə çox olduqda əsas mənfi ürək-damar hadisələri ehtimalını artırdığı bildirilir (9, 46). Buna görə də, Lp(a)-nı azaldan molekulyar və farmakoloji faktorların aydınlaşdırılması insan populyasiyasında mühüm terapevtik və farmakoloji nəticələri olan yeni bir məqsəd təşkil edir. Bu işdə biz öd turşusu ilə aktivləşdirilmiş FXR reseptorunu yüksək öd turşusu səviyyələri olan xəstələrdə və siçanlarda Lp(a) səviyyələrinin əsas repressoru kimi müəyyən etdik. Xüsusilə, öd turşusu konsentrasiyasının terapevtik normallaşması plazma Lp(a) səviyyəsinin artmasına səbəb olur. Eynilə, transgenikdə öd kanalının bağlanması APOA siçanlar faktiki olaraq ləğv edildi APOA ifadə. Buna görə də, yüksək intrahepatik öd turşusunu yatıra biləcəyini fərz etdik APOA ifadə. Öd turşusu ilə aktivləşdirilmiş FXR-nin repressiv olduğunu qəti şəkildə nümayiş etdirmək üçün APOA ifadəsini daha fizioloji vəziyyətdə, biz transgenik qidalandırdıq APOAFxr –/– transgenik APOA öd turşuları olan siçanlar. Safra turşusu ilə qidalanma APOA plazma konsentrasiyasını, həmçinin transgenikdə gen ifadəsini və protein səviyyələrini aşağı saldı APOA siçanlarda bir təsir ortadan qaldırıldı Fxr –/– transgenik APOA siçan. Bundan əlavə, FXR-nin öd turşuları və ya qeyri-steroid FXR agonisti ilə in vitro aktivləşdirilməsi azalıb. APOA transkripsiya mexanizminə görə zaman və dozadan asılı olaraq gen ifadəsi.

Normal fərdlərdə plazma Lp(a) səviyyələrinin APOA-nın sintez sürəti ilə əhəmiyyətli dərəcədə korrelyasiya olduğu göstərilmişdir (17, 18) və onun katabolizmindən minimal dərəcədə təsirlənir. Beləliklə, farmakoloji FXR aktivləşdirilməsi hiper-Lp(a) fərdlərinin müalicəsi üçün yeni və perspektivli bir yanaşma təşkil edə bilər və yüksək riskli əhalidə mənfi koronar hadisələri əhəmiyyətli dərəcədə azalda bilər. Maraqlıdır ki, yeni FXR agonistləri artıq siçanlarda antiaterosklerotik təsir göstərdiyi (47) və olmayan gəmirici modellərdə dislipidemiyanı (48) normallaşdırdığı göstərilmişdir. APOA ifadə. Buna görə də, INT-747 kimi FXR agonistlərindən istifadə etməklə davam edən insan klinik sınaqlarında Lp(a)-nın ölçülməsi maraqlı olacaq. Öd turşusunu bağlayan qatranların, ehtimal ki, FXR liqandını tükəndirməklə və buna görə də FXR aktivasiyasını azaltmaqla, xolesterin və qlükozuriyanın (50) azalması səbəbindən koronar xəstəliklərin (49) tezliyini azaltdığı göstərilmişdir. Daha yüksək öd turşusuna yaxınlıq, spesifiklik və bağlama qabiliyyəti olan yeni qatranlar hazırda mövcuddur və ya HMGCoA reduktaza inhibitorları (statinlər) ilə birlikdə, ya da statinlərə davamlı xəstələrdə təhlükəsiz terapevtik seçimdir. Bununla belə, bizim nəticələrimiz onu göstərir ki, dislipidemiya və potensial yüksəlmiş Lp(a) olan xəstələrdə qatranlar və bağırsaqda öd turşusu qəbulu inhibitorları diqqətlə izlənilməlidir. Əksinə, skrininq parametri kimi Lp(a)-nın tətbiqi ürək-damar sistemini daha da qoruyaraq əlavə təsirlər olmadan təkmilləşdirilmiş qatranlara gətirib çıxara bilər.

FXR-nin birbaşa repressiya etdiyi aşkar edildi APOA HNF4α ilə paylaşılan DR-1 saytına bağlanaraq promotor fəaliyyəti, transkripsiyanın yatırılmasına səbəb olur. Bir neçə molekulyar tənzimləyicinin promotor bölgəsinə bağlandığı və modulyasiya etdiyi aşkar edilmişdir APOA. Bunlara digərləri arasında HNF1, HNF4α, RXR və LINE üçün bağlama yerləri daxildir (51, 52). FXR qaraciyərdə yüksək şəkildə ifadə edilir və RXR ilə heterodimer kimi promotorlarda IR-1 cavab elementlərinə, eləcə də müxtəlif DR elementlərinə (24) bağlanır və bununla da qohum hədəf genlərini aktivləşdirir. Bundan əlavə, FXR monomerik cavab elementlərini bağlaya bilər və buna görə də gen transkripsiyasını birbaşa basdırır (24-27). Bu yaxınlarda, FXRE-nin yeri və ardıcıllığı ChIP və ardıcıllıqla sistematik olaraq tədqiq edilmişdir (53). Bu işdə Chong et al. 1656 bağlanma yeri, o cümlədən 10%-i promotorun proksimal 2 kb-də yerləşir. Üstəlik, bu FXRE-lərin 25%-ə qədəri klassik IR-1 deyildi. Tədqiqatımızda reportyor analizləri, sahəyə yönəldilmiş mutagenez, EMSA və ChIP-i birləşdirərək, biz birmənalı şəkildə transkripsiya başlanğıc yerindən -826-bp yuxarıda yerləşən DR-1-i yeni mənfi FXRE olduğuna inandığımız kimi müəyyən etdik. təbliğatçısı APOA. Buna görə də bu sayt vicdanlı FXRE arxitekturasına uyğun gəlir. Çünki Chong et al. bir siçan qaraciyərini ifadə etmədən istifadə etdi APOA xromatinlə zənginləşdirilmiş material, bizim cavab elementimiz onların verilənlər bazasında tapılmadı. Bununla belə, –826-dan –814-bp bölgəsində yerləşən DR-1-in transfeksiya, EMSA və ChIP ilə göstərildiyi kimi HNF4α ilə bağlandığı və aktivləşdirildiyi aşkar edildi. Bundan əlavə, Şəkil 7E-də göstərildiyi kimi, HNF4α rəqabətli şəkildə FXR tərəfindən dəyişdirildi. HNF4α-nın lipid, qlükoza və safra turşusu homeostazında iştirak etdiyi yaxşı bilinir (54). FXR və HNF4α arasında rəqabət əvvəllər promouterdə tapılmışdı APOCIII ( 24 , 43 , 44 ). Buna görə də, FXR və HNF4α-nın gen promotorlarına bağlanması arasındakı tarazlığın lipid homeostazında iştirak edən genlər şəbəkəsini koordinasiya edə biləcəyini düşünmək cazibədardır (Əlavə Şəkil 7). Bu yatırmanın dəqiq mexanizmi, o cümlədən qeyri-məhsuldar FXR-nin cavab elementinə bağlanmasında iştirak edən hadisələr əlavə tədqiqatlar tələb edir.

FXR həmçinin siçanı aktivləşdirir Fgf15, demək olar ki, yalnız terminal ileumda ifadə olunan bir gen və onun insan ortoloqu, FGF19, nazik bağırsaqda, eləcə də qaraciyərdə ifadə olunan bir gen. FGF15/19 öd turşusu biosintezinin əsas fermentlərinin transkripsiyasını sıxışdırmaq üçün bağırsaqdan qaraciyərə siqnal verir (34, 55). Xüsusilə, FXR aktivləşdirilməsi effektiv şəkildə basdırıldı APOA ifadə etməyən ilkin siçan hepatositləri in vitro Fgf15, FXR-nin tənzimləyə biləcəyini göstərir APOA gen FGF15/19-dan asılı olmayan şəkildə. FGF15/19-un mümkün əlavə rolunu aydınlaşdırmaq üçün əlavə tədqiqatlar tələb olunacaq APOA gen repressiyası.

Bundan əlavə, FXR induksiyası vasitəsilə gen ifadəsini dolayı yolla modullaşdıra bilər Şp qaraciyərdə (31). SHP transkripsiya repressoru olsa da, onun DNT bağlama motivi yoxdur (56), lakin LRH-1 və ya HNF4α kimi bir neçə nüvə reseptoru ilə qarşılıqlı əlaqədə olur və bununla da gen transkripsiyasına müdaxilə edir. Bu yaxınlarda SHP/LRH-1/CYP7A1 siqnal yolu təkzib edildi və LRH-1 əsas tənzimləyici kimi müəyyən edildi. Cyp8b1 ( 57 , 58 ).SHP bir çox partnyorla in vitro əlaqə qura bildiyindən, faktiki SHP hədəflərinin müəyyən edilməsi hələ də açıq bir araşdırmadır. Bizim transgenik APOA CA və ya FXR aktivatorları ilə inkubasiya edilmiş ilkin hepatositlərlə qidalanan siçanlarda daha çox aşkar edilmişdir. Şp və daha az APOA gen ifadəsi. Buna görə də biz maraqlandıq Şp induksiya repressiya edə bilər APOA. Bununla belə, SHP ifadə plazmidi ilə doza cavab transfeksiyası təcrübələri göstərdi ki, SHP repressiya etmədi, əksinə APOA HepG2-də, eləcə də COS-7 hüceyrələrində promotor fəaliyyəti (Əlavə Şəkil 6). Əksinə, FXR birbaşa repressiya edildi APOA HNF4α tərəfindən də tanınan DR-1-ə bağlanaraq promotor fəaliyyəti. Bu, DR-1 elementinin -826-dan -814-bp bölgəsində olduğunu təsirli şəkildə təsdiqləyən ChIP təhlili ilə təsdiqləndi. APOA promotor HNF4α tərəfindən işğal edilir, halbuki CA aktivləşdirilməsi saytın FXR tərəfindən tutulmasına səbəb olur (Şəkil 7E). Birlikdə götürdükdə məlumatlarımız SHP-nin tənzimləmədiyini göstərir APOA FXR-dən fərqli olaraq promotor.

Mövcud nəticələri nəzərə alaraq, FXR agonisti hiper-Lp(a) vəziyyətlərini müalicə etmək üçün yeni terapevtik yol təşkil edə bilər və aterosklerotik xəstəlik və miokard infarktı müalicəsində faydalı ola bilər. Bundan əlavə, bu nəticələr göstərir ki, insan klinik sınaqlarında plazma Lp(a) səviyyələrinə mümkün mənfi təsirlər üçün öd turşusu reseptor modulyatoru (BARM) adlanan indiki və gələcək FXR qismən agonistləri izlənilməlidir.

Kimyəvi maddələr. CA və CDCA Sigma-Aldrich-dən alınıb. GW4064 Tocris Bioscience-dən alınıb. Kollagenaz Worthington Biochemical Corporation-dan alınıb.

Xəstələr. Öd daşı və ya bədxassəli şişlər səbəbindən obstruktiv sarılıqdan əziyyət çəkən xəstələr öd yollarının obstruksiyası və plazma Lp(a) konsentrasiyasının markerləri üçün tədqiq edilmişdir. Əməliyyata və ya endoskopiyaya göndərilən xəstələrin qanı dərhal plazmada Lp(a), bilirubin, ümumi öd turşuları və LP-X səviyyələri üçün analiz edildi. Müvafiq müalicədən, sarılığın bərpasından və plazma bilirubinin normallaşmasından sonra plazma Lp(a) səviyyələri yenidən ölçüldü. Bütün insan tədqiqatları Qraz Tibb Universitetinin etik komitəsi tərəfindən təsdiqlənmiş və Helsinki Bəyannaməsinə uyğun olaraq həyata keçirilmişdir. Bütün xəstələrdən və ya onların valideynlərindən lipid və lipoprotein analizlərinin aparılması üçün əlavə qan alınması üçün məlumatlandırılmış razılıq alınmışdır.

Xəstələrdə plazma parametrlərinin və Lp(a)-nın təhlili. İnsan plazmasından olan lipidlər Roche Diaqnostikasının analiz dəstlərindən istifadə etməklə enzimatik olaraq ölçüldü. Lp(a) daxili DELFIA metodu ilə ölçüldü. Lp(a) və APOA-nın hazırlanması və Lp(a) analizinin standartlaşdırılması əvvəllər ətraflı təsvir edilmişdir (59). APOA izoformalarının təyini əvvəllər təsvir edildiyi kimi Western blotlama üsulu ilə həyata keçirilmişdir (60). LP-X standart üsullarla ölçüldü (61). Ümumi plazma öd turşuları enzimatik olaraq ölçüldü (62).

Heyvan təcrübələri. Bütün heyvan təcrübələri protokolun Avstriya Federal Elm və Tədqiqat Nazirliyi, Genetika Mühəndisliyi və Heyvan Təcrübələri Bölməsi (Vyana, Avstriya) tərəfindən təsdiqləndikdən sonra həyata keçirilmişdir. Fxr –/– siçanlar (28) 5 nəsil ərzində tg-APOA 110 kb insan daşıyan siçanlar APOA YAC-da 60-kb-dən çox 5′- və 3′-yan DNT ilə əhatə olunmuş gen (63). Siçanlar standart 12 saatlıq işıqlı/12 saatlıq qaranlıq dövrü ilə yerləşdirilib və standart gəmirici yemi və ad libitum su ilə qidalanıb. Bütün təcrübələrdə 10-12 həftəlik dişi siçanlar istifadə edilib. Qidalanma tədqiqatları üçün, tg-APOA (n = 8) və tg-APOA/Fxr –/– siçan (n = 8) insan APOA ifadə edən 2 qrupa bölündü. Heyvanlar plazma APOA səviyyələrinə əsasən randomizə edilmişdir. Bir qrup normal gəmirici yemək pəhrizi (nəzarət), digər qrup isə 5 gün ərzində 0,2% (ağırlıq/ağırlıq) CA ilə əlavə edilmiş eyni pəhriz qəbul etmişdir. Qurbanlıq zamanı siçanlar qan nümunələri toplanmazdan əvvəl 4 saat ac qaldılar. Qaraciyər və ileum nümunələri yığılmış və sonrakı analizlərə qədər -80°C-də saxlanılmışdır. ChIP analizi üçün qadın tg-APOA siçan (n = 3) 24 saat ərzində ya normal çov (nəzarət qrupu) və ya 0,2% CA ilə qidalanmışdır. Təzə təcrid olunmuş qaraciyər toxuması birləşdi və immunoprecipitation üçün xromatini təcrid etmək üçün istifadə edildi.

Siçanlarda plazma lipid parametrləri. Qan retro-orbital qanaxma ilə toplanmış və 20 dəqiqə ərzində EDTA plazması hazırlanmışdır. APOA-nın plazma konsentrasiyası daxili DELFIA üsulu ilə enzimatik olaraq ölçüldü. Plazma trigliseridləri (DiaSys) və ümumi xolesterol konsentrasiyaları (Greiner Diagnostics AG) istehsalçının protokollarına uyğun olaraq enzimatik olaraq təyin edilmişdir.

CBDL. On iki həftəlik qadın tg-APOA siçan (n = qrup başına 3-4) və tg-APOA/Fxr –/– siçan (n = 3 hər qrup) əvvəllər təsvir edildiyi kimi CBDL-ə məruz qaldı (64). Qısacası, ümumi öd axarı qaraciyər hilusuna yaxın, bifurkasiyanın dərhal altında bağlandı və ligaturlar arasında parçalandı. Şamla əməliyyat edilən heyvanlar eyni cərrahi əməliyyata məruz qaldılar, lakin ümumi öd axarının bağlanması aparılmadı. Əməliyyatdan 3 gün sonra sera və qaraciyər analiz üçün toplandı. Qaraciyər toxuması sonrakı RNT preparatları üçün maye azotda donduruldu. Serum analiz olunana qədər -80°C-də saxlanılır. Serum alanin aminotransferaza, aspartat aminotransferaza, qələvi fosfataza səviyyələri və bilirubin xolestaz dərəcəsinin ölçüləri kimi Hitachi 917 analizatorunda (Boehringer Mannheim) müntəzəm sınaqlarla müəyyən edilmişdir. Ümumi serum öd turşusu səviyyələri öd turşusu dəsti (Ecoline S+, DiaSys Diagnostic Systems) istifadə edərək enzimatik olaraq müəyyən edilmişdir.

Hüceyrə mədəniyyətləri. tg-dən siçan birincil hepatositləriAPOA siçanlar daha əvvəl təsvir edildiyi kimi (65) kiçik dəyişikliklərlə hazırlanmış və becərilmişdir. Siçan qaraciyəri kollagenaz məhlulu ilə perfuziya edildi və qaraciyər hüceyrələri toplandı. Süzgəcdən və sentrifuqadan sonra, təcrid olunmuş hepatositlər 20% (h/v) FCS (Sigma-Aldrich), 100 vahid/ml penisilin və 100 vahid/ml streptomisin əlavə edilmiş DMEM (Invitrogen)-də yenidən dayandırıldı və 6 quyulu kollagenə yerləşdirildi. -5% CO atmosferində 37°C-də 1 × 10 5 hüceyrə/quyuğun sıxlığında örtülmüş lövhələr (BD Biosciences)2 4 saat ərzində. Bundan sonra hüceyrələr 16 saat ərzində 10% FCS və 100 vahid/ml penisilin/streptomisin əlavə edilmiş DMEM-də becərildi. Təcrübələr CA və GW4064 FXR liqandlarının müxtəlif konsentrasiyaları ilə əlavə edilmiş serumsuz DMEM-də aparılmışdır.

HepG2 və COS7 hüceyrələri ATCC-dən əldə edilmişdir. Hüceyrələr 10% FCS və 100 vahid/ml penisilin/streptomisin ehtiva edən DMEM-də saxlanıldı.

RNT hasilatı, əks transkripsiya və real vaxtda PCR. Hüceyrələrdən və siçan toxumalarından ümumi RNT istehsalçının protokoluna uyğun olaraq TRI zol (Invitrogen) istifadə edərək təcrid olundu. İki mikroqram ümumi RNT Yüksək Tutumlu cDNA Əks Transkripsiya Kitindən (Tətbiq olunan Biosistemlər) istifadə edərək tərs transkripsiya edilmişdir. QuantiFast SYBR Yaşıl PCR Kitindən (Qiagen) istifadə edərək, Light Cycler 480 alətində (Roche Diaqnostika) kəmiyyət real vaxt PCR yerinə yetirildi. Primer ardıcıllıqları Əlavə Cədvəl 3-də verilmişdir. Gen ifadə dəyərləri siklofilin A (Ppia) ev təsərrüfatı geni kimi. Məlumatlar ictimai domen proqramı Relative Expression Software Tool (REST http://www.gene-quantification.de/download.html#rest) tərəfindən təhlil edilmişdir ( 66 ). Dəyərlər orta ± SEM kimi təqdim olunur.

Protein çıxarılması və immunoblotinq. Qaraciyərlər homojenləşdirildi və ya hüceyrələr buz kimi soyuq RIPA tamponunda parçalandı. Lizatlar sentrifuqa edilmişdir (12.000 g) 4°C-də 10 dəqiqə saxlandı və supernatant toplandı. Zülalın miqdarı Bradford protein analizindən (Bio-Rad) istifadə edilərək ölçüldü. Protein homogenatlarının ekvivalent miqdarı SDS-PAGE ilə həll edildi, nitroselüloz membranına köçürüldü və insan APOA-sına (1:1,250) və monoklonal anti-siçan β-aktinə (1:2,000) dovşan poliklonal antikorları ilə yoxlanıldı (Santa Cruz Biotechnology). Inc.). İmmunoblotlar Pierce ECL Chemiluminescence Detection System (Thermo Scientific) tərəfindən görüntülənib. Gellərin densitometrik analizi ImageJ proqram təminatından istifadə etməklə aparılmışdır ( http://rsbweb.nih.gov/ij/ ). Məlumatlar orta ± SD kimi təqdim olunur.

Birincili siçan hepatositlərinin adenovirus infeksiyası. tg-dən ilkin hepatositlər-APOA siçanlar təcrid olunmuş və LacZ və ya insanı kodlayan 50 və 100 MOI adenovirus ilə yoluxmadan əvvəl 24 saat saxlanılmışdır. HNF4A serumsuz DMEM-də. 4 saatlıq infeksiyadan sonra hüceyrələr 24 saat ərzində 10% FCS ilə əlavə edilmiş DMEM-də inkubasiya edildi, sonra RNT analizi üçün hüceyrə yığıldı.

Plazmidlər. hFXR (pcDNA3-FXR), hRXRα (pSG5-RXR), SHP (pCDM8-SHP) və HNF4α (pSG5-HNF4α) kodlayan ifadə plazmidləri Peter Young (Dupont, Oakley, California, ABŞ), Philippe Lefebvre (In) tərəfindən təmin edilmişdir. Pasteur de Lille, Lille, Fransa), David D. Moore (Baylor College of Tibb, Hyuston, Texas, ABŞ) və Mary C. Weiss (Institut Pasteur, Paris, Fransa). İnsan APOA promotor quruluşu (hAPOA –1,952/+52) şablon kimi insan genomik DNT istifadə edərək PCR gücləndirilməsi ilə əldə edilmişdir. PCR məhsulu pGL3 əsas vektoruna (Promega) klonlaşdırılmışdır MluI/BglII insan yaratmaq üçün fraqment APOA-Luc. (İstifadə olunan primerlər aşağıdakılardır: irəli reaksiya üçün, 5′-ACGCGTTCTGAGAGGGAGGTCAAAGTTTTC-3′ və əks reaksiya, 5′-AGATCTCTTGAGAAAGCCAGCCCCAAAGGT-3′.) Bütün konstruksiyalar DNT ardıcıllığı (LGC Genomics) ilə təsdiq edilmişdir.

Keçici transfeksiya və reportyor gen analizləri. HepG2 hüceyrələri transfeksiyadan əvvəl gecə ərzində 24 quyu boşqablara yerləşdirildi. 60%-70% birləşmədə olan hüceyrələr istehsalçının təlimatlarına uyğun olaraq FuGENE 6 reagentindən (Roche Diagnostics) istifadə edilməklə, reseptor ifadəli plazmidlərlə (150 ng) və ya onsuz (150 ng) göstərilən məruzəçi plazmid (150 ng) ilə müvəqqəti olaraq transfeksiya edilmişdir. Transfeksiyanın effektivliyini qiymətləndirmək üçün β-qalaktosidaza ifadə plazmidi kotransfektsiya edilmişdir. 12 saatlıq transfeksiyadan sonra mühit dəyişdirildi və hüceyrələr liqandlara (CDCA [100 μmol/l], GW4064 [500 nmol/l]) və ya vasitəyə məruz qaldı. 36 saatdan sonra hüceyrə ekstraktları passiv lizis tamponundan (Promeqa) istifadə edilərək hazırlanmış və müvafiq olaraq Luciferase Assay System və β-qalaktosidaza Ferment Təhlil Sistemi (Promega) istifadə edərək lusiferaza və β-qalaktosidaza fəaliyyətləri üçün sınaqdan keçirilmişdir. Lusiferaza fəaliyyətləri Lumat LB9501 (Berthold) istifadə edərək ölçüldü və hər bir transfeksiya edilmiş quyu üçün β-qalaktosidaza fəaliyyətlərinə normallaşdırıldı. Hər bir eksperimental sınaq üçün quyular üç nüsxədə transfeksiya edildi və hər bir quyu iki nüsxədə yoxlanıldı. Məlumatlar orta ± SD kimi təqdim olunur.

Sahəyə yönəldilmiş mutagenez. Mutagenez istehsalçının təlimatına uyğun olaraq QuikChange Sayta Yönləndirilmiş Mutagenez Sistemi (Stratagene) istifadə edərək həyata keçirilmişdir. Mutantlar ardıcıllıqla yoxlanılıb. Oliqonukleotidlər M1 (5′-GAGGGTTGGAAGCAAGAGGGGsaatCCAACGCGCACGGGGAGGAAGC-3′) və M2 (5′-GAAGCAAGAGGGGGGCCAACsaatGCACGGGGAGGAAGCATTTGGGCAG-3′) mutasiyaları tam uzunluqlu saata daxil etmək üçün istifadə edilmişdir.APOA –1,952/+52. Mutasiya edilmiş əsaslar qalın, kiçik hərflərlə göstərilir və altı çizili hərflər DR-1 elementini müəyyən edir.

EMSA-lar. İnsan FXR, RXR və HNF4α zülalları TNT T7 Quick Coupled Transkripsiya/Tərcümə Sistemi (Promega) istifadə edərək in vitro sintez edilmişdir. DR-1 WT (5′-AGGGGGGCCAACGCGCACGGG-3′), DR-1 M2 (5′-AGGGGGGCCAACatGCACGGG-3′) və FXR IR-1 konsensus cavab elementi (oliqonukleotid tərkibli IR-in) hiss və antisens oliqonukleotid zondları 1, 5′-GATCTCAAGAGGTCATTGACCTTTTTG-3′) T4 polinükleotid kinaz və γ- 32 P-ATP (Hartmann Analytic GmbH) istifadə edərək 5′ ucunda tavlanmış və radioaktiv olaraq etiketlənmişdir (mutasiya olunmuş əsaslar qalın, kiçik hərflərlə və alt xəttli hərflərlə göstərilir) IR-1 elementini təyin edin). Birləşdirilməmiş nukleotidlər Micro Bio-Spin 6 Columns (Bio-Rad) istifadə edərək çıxarıldı. In vitro tərcümə edilmiş zülallar (2.0 μl) etiketli zond əlavə edilməzdən əvvəl bağlayıcı bufer (Gel Shift Assay System, Promega) ilə ümumi həcmdə 10 μl həcmdə otaq temperaturunda 20 dəqiqə inkubasiya edilmişdir. Bağlama reaksiyaları daha 30 dəqiqə inkubasiya edildi və otaq temperaturunda və 120 V-da 3,5 saat ərzində 0,25X Tris-Borat-EDTA tamponunda 6% denaturasiya etməyən poliakrilamid gel elektroforezi ilə həll edildi. Gel qurudulmuş və rentgen filminə məruz qalmışdır. Rəqabət təcrübələri üçün etiketlənməmiş zondlar göstərilən artıq konsentrasiyalarda bağlama reaksiyasına daxil edilmişdir.

CHIP analizi. İn vivo ChIP analizi EpiQuik Tissue ChIP Kit (Epigentek) istifadə edərək, istehsalçının göstərişlərinə uyğun olaraq, kiçik dəyişikliklərlə təzə təcrid olunmuş siçan qaraciyər toxuması ilə aparılmışdır. Qaraciyər toxuması formaldehiddə 12 dəqiqə sabitləndi və sonra 5 dəqiqə qlisinlə söndürüldü. Nüvələr çıxarıldı və 500-dən 1000-ə qədər DNT fraqmentləri əldə etmək üçün sonikasiya edildi. Kəsilmiş xromatinin hissəcikləri daha sonra 4 μg anti-FXR (sc-13063 Santa Cruz Biotechnology Inc.), anti-RXR (sc-553 Santa Cruz Biotechnology Inc.), 2 μg anti-HNF4α antikoru (sc-6556 Santa Cruz) istifadə edərək immunoçökmə edildi. Biotechnology Inc.) və ya 1 μg anti-IgG antikoru. Müsbət nəzarət kimi çökməmiş xromatin (giriş) istifadə edilmişdir. DNT ekstraksiyaları aşağıdakı yan primerlərdən istifadə edərək PCR gücləndirildi və PCR məhsulları agaroz gel elektroforezi ilə təhlil edildi: DR-1 elementi APOA promotor (DR-1 çip irəli, 5′ TTGGCAGTGTTTTTGGGAGAC 3′ DR-1 çip tərs, 5′ ACAGGCAGTTCCATCACTCC 3′), distal bölgə APOA promotor (distal ChIP irəli, 5′ TCTCCCCTTCATGTTTCCAG 3′ distal ChIP tərs, 5′ CCAGTGGCCGACATAGAGAT 3′) və Şp promotor (Shp ChIP irəli, 5′GCCTGAGACCTTGGTGCCCTG 3′ Shp ChiP tərs, 5′ CTGCCCACTGCCTGGATGC 3′).

Statistika. Təcrübələrin statistik təhlili GraphPad Prism 5.0 ilə aparılmışdır. İki quyruqlu, qoşalaşmamış Tələbələr t statistik əhəmiyyətini müəyyən etmək üçün test tətbiq edilmişdir.

Bu iş Qrats Tibb Universiteti (İ. Chennamsetty və A. Bagdasaryan “Molekulyar Təbabət” PhD proqramı tərəfindən maliyyələşdirilir), Avstriya Elm Fondu FWF (SFB-LIPOTOX F3004, F3008 və P19186) və Avstriya tərəfindən dəstəklənib. Federal Elm və Tədqiqat Nazirliyi (GEN-AU layihəsi Lipidlərlə əlaqəli pozğunluqların genomikası — GOLD). Müəlliflər əla texniki köməyə görə A. İbovnikə təşəkkür edirlər.

Maraqların toqquşması: Müəlliflər heç bir maraq toqquşmasının olmadığını bəyan ediblər.

İstinad məlumatı: J Clin Invest. 2011121(9):3724–3734. doi: 10.1172/JCI45277.


Giriş seçimləri

1 il ərzində jurnala tam giriş əldə edin

Bütün qiymətlər NET qiymətləridir.
ƏDV daha sonra ödəniş zamanı əlavə olunacaq.
Vergi hesablanması yoxlama zamanı yekunlaşacaq.

ReadCube-da vaxt məhdud və ya tam məqaləyə giriş əldə edin.

Bütün qiymətlər NET qiymətləridir.


Təşəkkürlər

Transgenez və biokimyəvi analizlərdə köməyə görə K Kourouniotis və G Fragiadakis-ə, mikroarraylar və verilənlər bazası təqdimatı ilə texniki dəstəyə görə C Pritchard, H Hilton və D Williams-a və serumun bioanalitik kimyasına görə R Nilsson və L Swensson-a təşəkkür edirik. Mikroarrayların təmin edilməsinə görə MRC Rosalind Franklin Mərkəzinə (keçmiş Böyük Britaniya HGMP Resurs Mərkəzi) də təşəkkür edirik. Bu iş GSRT və Aİ-nin qrantları (QLRT-2000-01513 və LSHG-CT-2004-502950) tərəfindən dəstəklənib.


Videoya baxın: 5-25, 5-26, 4-3: Throat cultures, CAMP test and Bile Esculin Agar (Dekabr 2022).